<?xml version="1.0" standalone="yes"?>
<Stanford_Algorithm_Interpretation>
<algorithmVersion>java-beta-0.9.1</algorithmVersion>
<webServiceVersion>beta-0.9.2</webServiceVersion>
<success>
<sequence>CCTCAAATCACTCTTTGGCAACGACCCATCGTCACAATAAGGATAGGAGGGCAACTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGAAAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTGTCAAAGTAAGACAGTATGAGCAGATACCCGTAGAAATCTGCGGACATAAAGTTATAGGTACAGTATTAGTAGGACCTACACCTGCCAACATAATTGGAAGAAATCTGATGACTCAGCTTGGTTGTACTTTAAATTTTCCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAGGAAAAAATAAATGCATTAGTAGAAATTTGTGCAGAAATGGAAAAGGAAGGGAAAATTTCWAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCYATAAAGAAAAAGAACAGTACTAGATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCKCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATACTTTTCAGTTCCCTTATATGAAGACTTTAGAAAGTATACTGCATTTACCATACCTAGTAAAAACAATGAGACACCAGGGATTAGATACCAGTATAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCTTTTAGACAACAAAATCCAGACCTAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAACTGAGACAACATCTGTTGAGGTGGGGATTTTTCACACCAGATCAAAAACATCAGAARGAACCYCCATTCCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATACAGCTGCCAGAA</seqeunce>
<PR_present>true</PR_present>
<RT_present>true</RT_present>
<PR_mutations>
<mutation>L10I</mutation>
<mutation>K14R</mutation>
<mutation>R41K</mutation>
<mutation>I54V</mutation>
<mutation>D60E</mutation>
<mutation>L63P</mutation>
<mutation>I64V</mutation>
<mutation>A71V</mutation>
<mutation>V82A</mutation>
<mutation>L90M</mutation>
<mutation>I93L</mutation>
</PR_mutations>
<RT_mutations>
<mutation>K32N</mutation>
<mutation>T39A</mutation>
<mutation>D67N</mutation>
<mutation>K70R</mutation>
<mutation>A98AS</mutation>
<mutation>D121Y</mutation>
<mutation>K122E</mutation>
<mutation>I135K</mutation>
<mutation>K173Q</mutation>
<mutation>I178L</mutation>
<mutation>T215F</mutation>
<mutation>K219Q</mutation>
<mutation>V245Q</mutation>
</RT_mutations>
<drugScores>
<drug code="3TC" score="4" levelStanford="1" levelSIR="S" />
<drug code="ABC" score="33" levelStanford="4" levelSIR="I" />
<drug code="APV" score="42" levelStanford="4" levelSIR="I" />
<drug code="ATV" score="57" levelStanford="4" levelSIR="I" />
<drug code="AZT" score="83" levelStanford="5" levelSIR="R" />
<drug code="D4T" score="52" levelStanford="4" levelSIR="I" />
<drug code="DDI" score="28" levelStanford="3" levelSIR="I" />
<drug code="DLV" score="0" levelStanford="1" levelSIR="S" />
<drug code="EFV" score="0" levelStanford="1" levelSIR="S" />
<drug code="FTC" score="4" levelStanford="1" levelSIR="S" />
<drug code="IDV" score="72" levelStanford="5" levelSIR="R" />
<drug code="LPV" score="49" levelStanford="4" levelSIR="I" />
<drug code="NFV" score="107" levelStanford="5" levelSIR="R" />
<drug code="NVP" score="0" levelStanford="1" levelSIR="S" />
<drug code="RTV" score="72" levelStanford="5" levelSIR="R" />
<drug code="SQV" score="67" levelStanford="5" levelSIR="R" />
<drug code="TDF" score="28" levelStanford="3" levelSIR="I" />
</drugScores>
<comments>
<comment id="PR_POS10">L10I/V/F/R are associated with resistance to each of the PIs when present with other mutations. L10F may be more significant because it rarely occurs in the absence of PI therapy. L10Y is a rare treatment-associated mutation. </comment>
<comment id="PR_POS54">I54V contributes resistance to each of the PIs when present with other mutations. I54M/L occur in patients receiving APV and causes low-to-intermediate APV resistance. I54T/S/A are also selected by PIs; their precise effect on drug susceptibility is not known. </comment>
<comment id="PR_POS63">L63P is a common polymorphism that is associated with resistance to PIs when present with other mutations. The effects of other mutations at this position - which occur not too infrequently - have not been studied. </comment>
<comment id="PR_POS71">A71V/T is associated with resistance to each of the PIs when present with other mutations. A71I is associated with PI treatment; its effect on susceptibility to individual PIs is not known. </comment>
<comment id="PR_POS82">V82A/T/F/S reduce susceptibility to IDV, RTV, and LPV. When present with other mutations, V82A/T/F/S also reduce susceptibility to APV, NFV, SQV, and ATV. V82I is a polymorphism that is common in some non-B subtypes; it has little if any effect on PI susceptibility. V82M is particularly common in subtype G isolates and reduces IDV susceptibility. </comment>
<comment id="PR_POS90">L90M causes resistance to SQV and NFV. When present with other mutations it also compromises the activity of IDV, RTV, APV, LPV, and ATV. </comment>
<comment id="PR_POS93">I93L is a common polymorphism that is associated with resistance to PIs when present with other mutations. I93M is a PI-associated mutation; its effect on susceptibility is not known. </comment>
<comment id="RT_POS67NEG">D67N contributes some degree of resistance to each of the NRTIs except 3TC and FTC. It usually occurs with mutations at positions 70 or 215. D67E/G occur in heavily treated patients and probably have a similar effect as D67N. </comment>
<comment id="RT_POS70">K70R causes low-level AZT resistance but appears to have little effect on the other NRTIs. K70E/G/N are rare variants at this position that tend to occur in heavily treated persons. The precise effect of these mutations is not known. </comment>
<comment id="RT_POS98">A98G causes low-level (about 2-fold) resistance to NVP. However, by itself it may not necessarily compromise drug activity. It is also a rare polymorphism that occurs in about 1% of NNRTI-naive persons. A98S is a common polymorphism that does not cause NNRTI resistance. </comment>
<comment id="RT_POS215">T215Y/F cause AZT and D4T resistance and also limits the effectiveness of ABC, DDI, and TDF but for these drugs it appears that mutations at positions 41 and 210 are often also required. 215S/C/D/E/I/V represent transitions between wild type and the mutations Y and F. Most of these have no phenotypic effect. But their presence suggests that a resistant virus that harbors T215Y or F may have been transmitted. </comment>
<comment id="RT_POS219">K219Q/E increase AZT resistance when present with K70R or T215Y/F but may not have any effect on the remaining NRTIs. K219N/R occur commonly in heavily NRTI-treated patients and may have a similar effect to K219Q/E. </comment>
</comments>
</success>
</Stanford_Algorithm_Interpretation>