Example of how changing <success> affected a sequence with no genes

On 03/03/10, the meaning for the existing boolean element, <success>, under the complexType <Result> was modified to indicate whether the sequence was successfully processed instead of whether an interpretation was successful. This was done to better explain what happened to the submitted sequence.

In this example, we show how this change affected a sequence with no protease, RT, or integrase genes to interpret. Previously, the value of the <success> element, was "false" (accompanied with the string element <errorMessage>); now the value is "true" (alongside a complexType <geneData> element for each gene with the boolean subelement <present> with the value "false")

Previous Version

    <result>
        <success>false</success>
        <inputSequence>
            <md5sum>c95786f5467edda6e466d05736470f25</md5sum>
            <name>gi|46254442|gb|AY561245.1| HIV-1 isolate PCM031 from Colombia envelope 
                  glycoprotein (env), rev protein (rev), and tat protein (tat) genes, partial
                  cds; and nef protein (nef) gene, complete cds</name>
            <sequence>CAGGCCTGTCCAAAGGTATCCTTTGATCCAATTCCCATACATTATTGTGCCCCAGCTGGTTTTGCG
	              CTTCTAAAGTGTAGAGATAAGAACTTCAATGGAACAGGATTATGTAAAAATGTCAGCACAGTACAATG...</sequence>
        </inputSequence>
        <errorMessage>There were no Protease, Reverse Transcriptase, or Integrase genes found,
	             refuse to process (sequence length = 2780).</errorMessage>
    </result>
Current Version
    <result>
        <success>true</success>
        <inputSequence>
            <md5sum>c95786f5467edda6e466d05736470f25</md5sum>
            <name>gi|46254442|gb|AY561245.1| HIV-1 isolate PCM031 from Colombia envelope
                  glycoprotein (env), rev protein (rev), and tat protein (tat) genes, partial
		  cds; and nef protein (nef) gene, complete cds</name>
            <sequence>CAGGCCTGTCCAAAGGTATCCTTTGATCCAATTCCCATACATTATTGTGCCCCAGCTGGTTTTGCG
	              CTTCTAAAGTGTAGAGATAAGAACTTCAATGGAACAGGATTATGTAAAAATGTCAGCACAGTACAATG...</sequence>
        </inputSequence>
        <geneData>
            <gene>PR</gene>
            <present>false</present>
        </geneData>
        <geneData>
            <gene>RT</gene>
            <present>false</present>
            <quality>
                <criteriaFailed>Total insertion amino acid count: 190 (max allowed: 50)</criteriaFailed>
                <criteriaFailed>AA sequence length: 70 (min allowed: 100)</criteriaFailed>
            </quality>
        </geneData>
        <geneData>
            <gene>IN</gene>
            <present>false</present>
            <quality>
                <criteriaFailed>Total insertion amino acid count: 327 (max allowed: 50)</criteriaFailed>
                <criteriaFailed>Mutation %: 72.3 (max allowed: 23.0)</criteriaFailed>
                <criteriaFailed>AA sequence length: 83 (min allowed: 120)</criteriaFailed>
            </quality>
        </geneData>
    </result>