Many changes were made to the NRTI and NNRTI drug-resistance mutation scores. Many NRTI, NNRTI, and PI comments were also updated.

We have made the effect of these changes transparent by including an excel spreadsheet with the following data: (i) unique mutation patterns from HIV-1 RT sequences from >40,000 persons, (ii) the calculated estimate of susceptibility to each ARV of a class, (iii) the changes from the previous version of the algorithm to the current version. The NRTI and NNRTI spreadsheets have 2,081 and 1,104 unique patterns of scored mutations.

Each spreadsheet has two worksheets:

• "Score Changes By Drug" shows only the patterns where there is a difference in score; for example, in the NNRTI spreadsheet, Rilpivirine (RPV) shows 192 rows indicating that the score of 912 drug resistance mutation patterns was left unchanged. More importantly, each row shows a mutation pattern with details on what the difference in scores is and what caused it; for example the first RPV row in the worksheet (shown below) shows the drug resistance mutation pattern "188L" a) occuring 129 times in our database, b) scoring 60 points, putting it in the highest resistance category, "High-level resistance (5)", a three level increase from "Potential low-level resistance (2)" with a score of 10, and c) changing in levels because mutation 188L increased by 50 points.

  DRMPattern	Count	Drug	Old version level	New version level	Old version score	New version score	Level difference	Score differences responsible for change
  188L	129	RPV	2	5	10	60	3	Y188L 50

• "Mutation Patterns" in the other hand shows all patterns in decreasing order of frequency with old (prefix 'o') and new (prefix 'n') drug intepretation levels.

Lastly, almost all PI comments were updated. As usual, our latest comment information is available at this link;

Scores for rilpivirine (RPV) have been added and scores for delavirdine (DLV) are no longer available in our interpretation programs.
As usual, our latest scoring information is available at this link; but we are also making available a copy of the last version of files with scores and/or comments for DLV in various formats: tab-delimited scores, and tab-delimited comments, and XML (which you can use to compare against other algorithms in HIValg).

Lastly, almost all NNRTI comments were updated. As usual, our latest comment information is available at this link;

• question mark '?' is now an accepted nucleotide, it is replaced with an 'N'; it used to be deleted
• dashes '-'s and tildes '~'s in the middle of a sequence are now deleted, so the alignment program can then insert a gap and a deletion reported; a dash '-' used to be replaced with an 'N' and a tilde '~' deleted.
• if a triplet codon has an 'N' and it can be translated into multiple amino acids, it just translates to an X; it used to translate to whatever the AA mixture was unless it was >4 then it translated to an X.
  For example, 'AAN' translates to 'X', it used to translate to 'KN'. An 'N' is likely to identifiy an unknown base and do not want the AA mixture to affect the resistance scoring, prevalence calculations, or identifying hypermutated sequences. Our translation depends on a text file which I am providing in both the new version and the older version for your comparison.
• codon positions with ambiguous bases are flagged even if it is a silent mutation. Previously we only flagged those ambiguous bases that led to a mutation.
  For example, 'TCN' at position 147 in integrase translates to the consensus AA Serine so it will appear in the ambiguous row in the Quality portion of the report but will be missing from the resistance mutations portion.

• Talbot A, Grant P, Taylor J, Baril JG, Liu TF, Charest H, Brenner B, Roger M, Shafer R, Cantin R, Zolopa A (2010). Predicting tipranavir and darunavir resistance using genotypic, phenotypic, and virtual phenotypic resistance patterns: an independent cohort analysis of clinical isolates highly resistant to all other protease inhibitors. Antimicrob Agents Chemother. 54(6):2473-9.
• Rhee SY, Taylor J, Fessel WJ, Kaufman D, Towner W, Troia P, Ruane P, Hellinger J, Shirvani V, Zolopa A, Shafer RW (2010). HIV-1 Protease Mutations and Protease Inhibitor Cross Resistance. Antimicrob Agents Chemother. [in press]

• Talbot A, Grant P, Taylor J, Baril J-G, Charest H, Liu T, Brenner B, Roger M, Shafer R, Cantin R, Zolopa A (2009). Genotypic, phenotypic and virtual phenotypic resistance patterns for tipranavir (TPV) and darunavir (DRV): an independent analysis of a Quebec HIV-1 cohort highly resistant to all other protease inhibitors. [Abstract WEPEB202] 5th IAS Conference on HIV Pathogenesis, Treatment and Prevention; Cape Town, South Africa.
• Rhee S-Y, Horberg M, Follansbee S, Hurley L, Liu T, Klein D, Fessel WF, Shafer RW (2009). Virologic Response to Raltegravir (RAL) Salvage and Maintenance Therapy. 47th Annual Meeting of the Infectious Diseases Society of America; Philadelphia, PA.
• Nijhuis M, Wensing AM, Bierman WF, de Jong D, Kagan R, Fun A, Jaspers CA, Schurink KA, van Agtmael MA, Boucher CA (2009). Failure of treatment with first-line lopinavir boosted with ritonavir can be explained by novel resistance pathways with protease mutation 76V. J Infect Dis 200(5):698-709.
• Arastéh K, Yeni P, Pozniak A, Grinsztejn B, Jayaweera D, Roberts A, Hoy J, De Meyer S, Vangeneugden T, Tomaka F (2009). Efficacy and safety of darunavir/ritonavir in treatment-experienced HIV type-1 patients in the POWER 1, 2 and 3 trials at week 96. Antivir Ther 14(6):859-64.
• Van Marck H, Dierynck I, Kraus G, Hallenberger S, Pattery T, Muyldermans G, Geeraert L, Borozdina L, Bonesteel R, Aston C, Shaw E, Chen Q, Martinez C, Koka V, Lee J, Chi E, de Béthune MP, Hertogs K (2009). The impact of individual human immunodeficiency virus type 1 protease mutations on drug susceptibility is highly influenced by complex interactions with the background protease sequence. J Virol 83(18):9512-20. Epub 2009 Jul 8.
• Lefebvre E, Schiffer CA (2008). Resilience to resistance of HIV-1 protease inhibitors: profile of darunavir. AIDS Rev 10(3):131-42.
• McKinnell JA, Lin HY, Nevin CN, Willig JH, McFarland G, Genz M, Raper JL, DeLaitsch LL, Mrus JM, Klaskala W, Mugavero MJ, Saag MS (2009). Early virologic suppression with three-class experienced patients: 24-week effectiveness in the darunavir outcomes study. AIDS 23(12):1539-46.
• De Meyer S, Lathouwers E, Dierynck I, De Paepe E, Van Baelen B, Vangeneugden T, Spinosa-Guzman S, Lefebvre E, Picchio G, de Béthune MP (2009). Characterization of virologic failure patients on darunavir/ritonavir in treatment-experienced patients. AIDS 23(14):1829-40.

• If an insertion falls in the RT gene between positions 66 and 70 (inclusive), we force it to position 69 to trigger its scoring. In the example below, the original alignment of the sequence has the insertion AAGTAG at aa position 67. This an excerpt from the original alignment (the query nucleotide sequence is on top and the reference amino acid at the bottom)

     180     .    :    .    :    .    :    .    :    .    :    .    :
     482 TTTGCTATAAAGAAAAAAGAAAGTAGTAGTGGTAAATGAAGAAAATTAGTAGATTTCAGA
         ::::::::::::::::::..------.:::  .:::.. :::::::::::::::::::::
      61 PheAlaIleLysLysLysAs      pSerThrLysTrpArgLysLeuValAspPheArg
  

  we then force the insertion in-frame and to aa position 69 as AGTGGT

     180     .    :    .    :    .    :    .    :    .    :    .    :
     482 TTTGCTATAAAGAAAAAAGAAAGTAGTAGTGGTAAATGAAGAAAATTAGTAGATTTCAGA
         ::::::::::::::::::.. :::   ------:::.. :::::::::::::::::::::
      61 PheAlaIleLysLysLysAspSerThr      LysTrpArgLysLeuValAspPheArg
  	                          ^ this is now the insertion at aa 69
  

  We are basically reversing a change introduced in version 6.0.1 to avoid changing the original nucleotide sequence.

• vastly updated all integrase comments

• Corrected the comments for RT mutations 74I and 74V
• If an insertion is out-of-frame, we force it to be in-frame. In the made-up example below, where the sequence has the insertion AAGTAG at aa position 37
  the new version now has an mutation (E) at position 37 since the codon is now GAA instead of GAT (D).
  This an excerpt from the original alignment (the query nucleotide sequence is on top and the reference amino acid at the bottom)

      90     .    :    .    :    .    :    .    :    .    :    .    :
     392 TTTGCTATAAAGAAAAAAGAAAGTAGTAGTGGTAAATGAAGAAAATTAGTAGATTTCAGA
         ::::::::::::::::::..------.:::  .:::.. :::::::::::::::::::::
      31 PheAlaIleLysLysLysAs      pSerThrLysTrpArgLysLeuValAspPheArg
  

      90     .    :    .    :    .    :    .    :    .    :    .    :
     392 TTTGCTATAAAGAAAAAAGAAAGTAGTAGTGGTAAATGAAGAAAATTAGTAGATTTCAGA
         ::::::::::::::::::   ------:::  .:::.. :::::::::::::::::::::
      31 PheAlaIleLysLysLysAsp      SerThrLysTrpArgLysLeuValAspPheArg
  

• We now flag every problem and potential problem at a codon. For instance, the mutation K64KMRT (codon ANG) is now flagged as having a highly ambiguous nucleotide (K64N) and resulting in atypical mutations (K64T and K64M) . A second case shows that E89*EKQ is now flagged ambiguous, atypical, and having a stop codon .
• Only valid mutations are used for classifying a mutation - ignoring Xs and stop codons (*). For instance, E138X and Q151*Q are now classified as OTHER whereas before they were classified as NNRTI and NRTI mutations, respectively.
• Multiple frameshifts are now properly delimited. Frameshifts are only used for flagging possible QA problems and not used for interpretation scoring or comments.
• List the mutation and insertion when both are found at the same position. For instance, if we have a mutation F and an insertion at position 215 we indicate this with T215Fi whereas before we would not have shown the mutation and just shown the insertion with T215i.
  The mutation present at the insertion position can also be a mixture. For instance, K13QRi indicates an insertion at position 13 along with the mutation "QR" which is coded by "CRG" representing "CAG" and "CGG".
• Insertion information is now more complete and accurate.
• If an insertion falls in the RT gene between positions 66 and 71 (inclusive), we force it to position 69 to trigger its scoring. In the example below, where the sequence has the insertion AAGTAG at aa position 67, the new version only has an insertion at position 69 whereas the previous version also has a mutation (D67E) with its associated comment and penalty scores for ABC, AZT, D4T, and DDI
  
  This an excerpt from the original alignment (the query nucleotide sequence is on top and the reference amino acid at the bottom)

     180     .    :    .    :    .    :    .    :    .    :    .    :
     482 TTTGCTATAAAGAAAAAAGAAAGTAGTAGTGGTAAATGAAGAAAATTAGTAGATTTCAGA
         ::::::::::::::::::..------.:::  .:::.. :::::::::::::::::::::
      61 PheAlaIleLysLysLysAs      pSerThrLysTrpArgLysLeuValAspPheArg
  

  the new version simply uses this alignment and reports the insertion AAGTAG to be at position 69

     180     .    :    .    :    .    :    .    :    .    :    .    :
     482 TTTGCTATAAAGAAAAAAGATAGTGGTAAGTAGAAATGAAGAAAATTAGTAGATTTCAGA
         ::::::::::::::::::...:::  .------:::.. :::::::::::::::::::::
      61 PheAlaIleLysLysLysAspSerThr      LysTrpArgLysLeuValAspPheArg
  	                          ^ this is now the insertion at aa 69
  

• Scherer J, Boucher CA, Baxter JD, Schapiro JM, Kohlbrenner VM, Hall DB (2007). Improving the prediction of virological response to tipranavir: the development of a tipranavir weighted score. [Poster P3.4/07] 11th European AIDS Conference; Madrid, Spain.
• De Meyer S, Dierynck I, Lathouwers E, Baelen BV, Vangeneugden T, Spinosa-Guzman S, Picchio G, De Bethune M-P (2008). Identification of mutations predictive of a diminished response to darunavir/ritonavir: analysis of data from treatment-experienced patients in POWER 1, 2, 3 and DUET-1 and DUET-2. [Poster 54] 6th European HIV Drug Resistance Workshop; Budapest, Hungary

• Rhee SY, Taylor J, Wadhera G, Ben-Hur A, Brutlag DL, Shafer RW (2006). Genotypic predictors of human immunodeficiency virus type 1 drug resistance. Proceedings of National Academy of Sciences of the United States of America Oct 25, 2006.
• Scherer J, Boucher CA, Baxter JD, Schapiro JM, Kohlbrenner VM, Hall DB (2007). Improving the prediction of virological response to tipranavir: the development of a tipranavir weighted score. [Poster P3.4/07] 11th European AIDS Conference; Madrid, Spain.
• Vermeiren H, Van Craenenbroeck E, Alen P, Bacheler L, Picchio G, Lecocq P; Virco Clinical Response Collaborative Team (2007).Prediction of HIV-1 drug susceptibility phenotype from the viral genotype using linear regression modeling. J Virol Methods 145(1):47-55. Epub 2007 Jun 15.

• Baxter JD, Schapiro JM, Boucher CA, Kohlbrenner VM, Hall DB, Scherer JR, Mayers DL (2006). Genotypic changes in human immunodeficiency virus type 1 protease associated with reduced susceptibility and virologic response to the protease inhibitor tipranavir. J Virol 80(21):10794-801. Epub 2006 Aug 23.
• Deforche K, Silander T, Camacho R, Grossman Z, Soares MA, Van Laethem K, Kantor R, Moreau Y, Vandamme AM; non-B Workgroup (2006).Analysis of HIV-1 pol sequences using Bayesian Networks: implications for drug resistance. Bioinformatics 22(24):2975-9. Epub 2006 Oct 4.
• Lanier ER, Givens N, Stone C, Griffin P, Gibb D, Walker S, Tisdale M, Irlbeck D, Underwood M, St Clair M, Ait-Khaled M (2004). Effect of concurrent zidovudine use on the resistance pathway selected by abacavir-containing regimens. HIV Med 5(6):394-9.
• Margot NA, Miller MD (2005). In vitro combination studies of tenofovir and other nucleoside analogues with ribavirin against HIV-1. Antivir Ther 10(2):343-8.
• Rhee SY, Taylor J, Wadhera G, Ben-Hur A, Brutlag DL, Shafer RW (2006). Genotypic predictors of human immunodeficiency virus type 1 drug resistance. Proceedings of National Academy of Sciences of the United States of America Oct 25, 2006.
• Scherer J, Boucher CA, Baxter JD, Schapiro JM, Kohlbrenner VM, Hall DB (2007). Improving the prediction of virological response to tipranavir: the development of a tipranavir weighted score. [Poster P3.4/07] 11th European AIDS Conference; Madrid, Spain.
• Vermeiren H, Van Craenenbroeck E, Alen P, Bacheler L, Picchio G, Lecocq P; Virco Clinical Response Collaborative Team (2007).Prediction of HIV-1 drug susceptibility phenotype from the viral genotype using linear regression modeling. J Virol Methods 145(1):47-55. Epub 2007 Jun 15.
• Wirden M, Marcelin AG, Simon A, Kirstetter M, Tubiana R, Valantin MA, Paris L, Bonmarchand M, Conan F, Kalkias L, Katlama C, Calvez V (2005). Resistance mutations before and after tenofovir regimen failure in HIV-1 infected patients. J Med Virol 76(3):297-301.

• Bradshaw D, Malik S, Booth C, Van Houtte M, Pattery T, Waters A, Ainsworth J, Geretti AM (2007) Characterization of a novel drug-resistance pattern associated with the mutations K70G and M184V in HIV-1 reverse transcriptase. Antimicrob Agents Chemother 2007 Sep 17; [Epub ahead of print].

• Andries K, Azijn H, Thielemans T, Ludovici D, Kukla M, Heeres J, Janssen P, De Corte B, Vingerhoets J, Pauwels R, De Bethune M-P. (2004) TMC125, a novel next-generation nonnucleoside reverse transcriptase inhibitor active against nonnucleoside reverse transcriptase inhibitor-resistant human immunodeficiency virus type 1. Antimicrob Agents Chemother 48(12):4680-6.
• Brillant JE, Klumpp K, Swallow S, Mirzadegan T, Cammack N, Heilek-Snyder G. (2004) In vitro Resistance Development for a second generation NNRTI: TMC125. [Poster 16] XIII International Drug Resistance Workshop; Canary Islands, Spain.
• Das K, Clark AD, Lewi PJ, Heeres J, De Jonge MR, Koymans LM, Vinkers HM, Daeyaert F, Ludovici DW, Kukla MJ, De Corte B, Kavash RW, Ho CY, Ye H, Lichtenstein MA, Andries K, Pauwels R, De Bethune M-P, Boyer PL, Clark P, Hughes SH, Janssen PA, Arnold E. (2004) Roles of conformational and positional adaptability in structure-based design of TMC125-R165335 (etravirine) and related non-nucleoside reverse transcriptase inhibitors that are highly potent and effective against wild-type and drug-resistant HIV-1 variants. J Med Chem 47(10):2550-60.
• Harrigan PR, Salim M, Stammers DK, Wynhoven B, Brumme ZL, McKenna P, Larder B, Kemp SD. (2002) A mutation in the 3' region of the human immunodeficiency virus type 1 reverse transcriptase (Y318F) associated with nonnucleoside reverse transcriptase inhibitor resistance. J Virol 76(13):6836-40.
• Katlama C, Campbell T, Clotet B, etal. (2007) DUET-2: 24 week results of a phase III randomised double-blind trial to evaluate the efficacy and safety of TMC125 versus placebo in 591 treatment-experienced HIV-1 infected patients. Abstract (late-breaker) WeSS204:2. 4th International AIDS Society Conference on HIV Pathogenesis, Treatment, and Prevention. Sydney, Australia.
• TMC125-C223 Writing Group, Nadler JP, Berger DS, Blick G, Cimoch PJ, Cohen CJ, Greenberg RN, Hicks CB, Hoetelmans RM, Iveson KJ, Jayaweera DS, Mills AM, Peeters MP, Ruane PJ, Shalit P, Schrader SR, Smith SM, Steinhart CR, Thompson M, Vingerhoets JH, Voorspoels E, Ward D, Woodfall B. (2007) Efficacy and safety of etravirine (TMC125) in patients with highly resistant HIV-1: primary 24-week analysis. AIDS 21(6):F1-10.
• Rhee SY, Taylor J, Wadhera G, Ben-Hur A, Brutlag DL, Shafer RW. (2006) Genotypic predictors of human immunodeficiency virus type 1 drug resistance. Proc Natl Acad Sci USA. 103(46):17355-60. Epub 2006 Oct 25.
• Sato A, Hammond J, Alexander TN, Graham JP, Binford S, Sugita K, Sugimoto H, Fujiwara T, Patick AK (2006) In vitro selection of mutations in human immunodeficiency virus type 1 reverse transcriptase that confer resistance to capravirine, a novel nonnucleoside reverse transcriptase inhibitor. Antiviral Res 70(2):66-74. Epub 2006 Jan 25.
• Su G, Li Y, Paul A, Hang J, Harris S, Hogg H, Dunn J, Yan J, Chow E, Cammack N, Klumpp K, Heilek G. (2007) In vitro Selection and Characterization of Viruses Resistant to R1206, a Novel Nonnucleoside Reverse Transcriptase Inhibitor. XVI International Drug Resistance Workshop; Barbados, Barbados.
• Vingerhoets J, Buelens A, Peeters M, Picchio G, Tambuyzer L, Van Marck H, De Smedt G, Woodfall B, De Bethune M-P. (2007) Impact of Baseline NNRTI Mutations on the Virologic Response to TMC 125 in the Phase III Clinical Trials DUET-1 and DUET-2. [Oral Presentation] [Poster 32] XVI International Drug Resistance Workshop; Barbados, Barbados.
• Vingerhoets J, Janssen P, Welkenhuysen-Gybels J, Peeters M, Cao-Van K, Tambuyzer L, Woodfall B, De Bethune M-P. (2006) Impact of baseline K103N or Y181C on the virological response to the NNRTI TMC125: analysis of study TMC125-C223. [Poster 17] XV International Drug Resistance Workshop; Sitges, Spain.
• Vingerhoets J, Azijn H, Fransen E, De Baere I, Smeulders L, Jochmans D, Andries K, Pauwels R, De Bethune M-P. (2005) TMC125 displays a high genetic barrier to the development of resistance: evidence from in vitro selection experiments. J Virol 79(20):12773-82.
• Vingerhoets J, De Baere I, Azijn H, Van den Bulcke T, McKenna P, Pattery T, Pauwels R, De Bethune M-P. (2004) Antiviral Activity of TMC125 against a Panel of Site-directed Mutants Encompassing Mutations Observed in vitro and in vivo. [Poster 621] 11th Conference on Retroviruses and Opportunistic Infections, San Francisco, CA.
• Vingerhoets J, Van Marck H, Velderman J, Peeters M, McKenna P, Pauwels R, De Bethune M-P. (2003) Antiviral Activity of TMC125, a Potent Next-Generation Non-Nucleoside Reverse Transcriptase Inhibitor (NNRTI), against >5000 Recombinant Clinical Isolates exhibiting a wide range of NNRTI Resistance. [abstract 8] 12th International HIV Drug Resistance Workshop; Los Cabos, Mexico.

• Delaunay C, Brun-Vezinet F, Landman R, Collin G, Peytavin G et al. (2005) Comparative selection of the K65R and M184V/I mutations in human immunodeficiency virus type 1-infected patients enrolled in a trial of first-line triple-nucleoside analog therapy (Tonus IMEA 021). J Virol 79(15): 9572-9578
• Gallant JE, Rodriguez AE, Weinberg WG, Young B, Berger DS et al. (2005) Early Virologic Nonresponse to Tenofovir, Abacavir, and Lamivudine in HIV-Infected Antiretroviral-Naive Subjects. J Infect Dis 192(11): 1921-1930.
• Ross L, Gerondelis P, Liao Q, Wine B, Lim ML et al. (2005) Selection of the HIV-1 reverse transcriptase mutation K70E in antiretroviral-naive subjects treated with tenofovir/abacavir/lamivudine therapy [abstract 92]. Antiviral Therapy 10 (Supplement 1): S102.
• Sluis-Cremer N, Sheen CW, Zelina S, Argoti Torres PS, Parikh UM et al. (2006) Molecular Mechanism by which K70E in HIV-1 Reverse Transcriptase Confers Resistance to Nucleoside Reverse Transcriptase Inhibitors. Antimicrob Agents Chemother.
• Van Houtte M, Staes M, Geretti A, Pattery T, Bacheler L (2006) NRTI resistance associated with the RT mutation K70E in HIV-1. Antivir Ther 11: S160.

• Baxter JD, Schapiro JM, Boucher CA, Kohlbrenner VM, Hall DB, Scherer JR, Mayers DL. (2006) Genotypic changes in human immunodeficiency virus type 1 protease associated with reduced susceptibility and virologic response to the protease inhibitor tipranavir. J Virol. 80(21):10794-801.
• Doyon L, Tremblay S, Bourgon L, Wardrop E, Cordingley MG. (2005). Selection and characterization of HIV-1 showing reduced susceptibility to the non-peptidic protease inhibitor tipranavir. Antiviral Res. 68(1):27-35.

• The list of major and minor protease inhibitor resistance mutations has been updated:
  
  • L76V has been added to the list of major mutations.
  • L23I, L24IF, L33FI, F53LY, G73ACST have been moved from the major mutation category to the minor mutation category.
  • Mutations at positions 20, 36, 63, and 77 have been moved from the minor mutation category to the other mutation category because they are highly polymorphic (meaning they occur commonly in the absence of therapy) and because in many cases substitutions at these positions represent the consensus amino acid in one or more non-B subtypes (Rhee AIDS 2006). Moreover, their contribution to decrease susceptibility is minimal and depends entirely on the presence of other mutations.
    In contrast, mutations at positions 10 and 71 occur in about 10% and 5% of PI-naive sequences from all subtypes and steadily increase in frequency with increasing therapy. Two mutations at position 10 (L10F/R) and one at position 71 (A71I) are also nonpolymorphic and remain as minor mutations.
  • V11I, E35G, K43T, Q58E, T74P, N83D, and L89V have been added to the minor mutation list.
• The list of atypical mutations was updated.
• In the "Mutation Scoring" tables, all mutations with scores are shown.
• Atypical mutations are shown first.

• Pellegrin I, Breilh D, Ragnaud JM, Boucher S, Neau D, Fleury H, Schrive MH, Saux MC, Pellegrin JL, Lazaro E, Vray M. (2006). Virological responses to atazanavir-ritonavir-based regimens: resistance-substitutions score and pharmacokinetic parameters (Reyaphar study). Antivir Ther. 11(4):421-9.
• Rhee SY, Kantor R, Katzenstein DA, Camacho R, Morris L, Sirivichayakul S, Jorgensen L, Brigido LF, Schapiro JM, and Shafer RW for the international Non Subtype B HIV-1 Working Group (2006). HIV-1 pol mutation frequency by subtype and treatment experience: extension of the HIVseq program to seven non-B subtypes. AIDS 20(5):643-651.

• drug name abbreviation for Prezista (darunavir) was changed from TMC114 to DRV
• drug name abbreviation for Lexiva (fosamprenavir) was changed from fAPV to FPV
• PI, NRTI, and NNRTI Comments were updated.

• Baxter JD, Schapiro JM, Boucher CA, Kohlbrenner VM, Hall DB,Scherer JR, Mayers DL. (2006). Genotypic changes in human immunodeficiency virus type 1 protease associated with reduced susceptibility and virologic response to the protease inhibitor tipranavir. J Virol. 80(21):10794-801.
• Elston R, Scherer J, Hall D, Schapiro J, Bethell R, Kohlbrenner V and Mayers D. (2006). De-selection of the I50V mutation occurs in clinical isolates during aptivus/r (tipranavir/ritonavir)-based therapy. Antivir Ther. 11:s102.
• Pellegrin I, Breilh D, Ragnaud JM, Boucher S, Neau D, Fleury H, Schrive MH, Saux MC, Pellegrin JL, Lazaro E, Vray M. (2006). Virological responses to atazanavir-ritonavir-based regimens: resistance-substitutions score and pharmacokinetic parameters (Reyaphar study). Antivir Ther. 11(4):421-9.
• Piliero PJ, Parkin N, Mayers D. (2006). Impact of protease mutations L33F, V82A, I84V, and L90M on ritonavir (RTV)-boosted protease inhibitor susceptibility. 46th ICAAC. September 27-30, 2006. San Francisco. Abstract H-998.

• De Meyer S, Hill A, De Bacre I, Rimsky L, et al (2006). Effect of baseline susceptibility and on-treatment mutations on TMC114 and control PI efficacy: preliminary analysis of data from PI-experienced patients from POWER 1 and POWER 2. [Abstract 157] 13th Conference on Retroviruses and Opportunistic Infection; Denver, Colorado.
• De Meyer S, Vangeneugden T, Lefebvre E, et al (2006). Phenotypic and genotypic determinants of resistance to TMC114: pooled analysis of POWER 1, 2 and 3. [Abstract 73] XV International Drug Resistance Workshop; Sitges, Spain.
• Tibotec, Inc. (2006). Prezista (darunavir, TMC114) prescribing information. PDF version

• Ross LL, Dretler R, Gerondelis P, Rouse EG, Lim ML, Lanier ER (2006). A rare HIV reverse transcriptase mutation, K65N, confers reduced susceptibility to tenofovir, lamivudine and didanosine. AIDS20(5):787-9.

• Parkin N and Chappey C. (2005). Protease mutations associated with higher or lower than expected Tipranavir (TPV) susceptibility basd on the TPV mutation score [poster 637]. 13th Conference on Retroviruses and Opportunistic Infections, Denver, CO.

1. Doyon L, Tremblay S, Bourgon L, Wardrop E, Cordingley MG. (2005). Selection and characterization of HIV-1 showing reduced susceptibility to the non-peptidic protease inhibitor tipranavir. Antiviral Res. 68(1):27-35.
2. Larder BA, Hertogs K, Bloor S, van den Eynde CH, DeCian W, Wang Y, Freimuth WW, Tarpley G. (2000). Tipranavir inhibits broadly protease inhibitor-resistant HIV-1 clinical samples. AIDS. 14(13):1943-8.
3. Boehringer Ingelheim Pharmaceuticals, Inc. (2006). Aptivus (Tipranavir) prescribing information. PDF version

1. Huang, W., A. Gamarnik, K. Limoli, C. J. Petropoulos, and J. M. Whitcomb. (2003). Amino acid substitutions at position 190 of human immunodeficiency virus type 1 reverse transcriptase increase susceptibility to delavirdine and impair virus replication. J. Virol. 77:1512-23.
2. Marcelin, A. G., P. Flandre, J. Pavie, N. Schmidely, M. Wirden, O. Lada, D. Chiche, J. M. Molina, and V. Calvez. (2005). Clinically relevant genotype interpretation of resistance to Didanosine. Antimicrob. Agents Chemother. 49:1739-44.
3. Parkin, N. T., S. Gupta, C. Chappey, and C. J. Petropoulos. (2006). The K101P and K103R/V179D Mutations in Human Immunodeficiency Virus Type 1 Reverse Transcriptase Confer Resistance to Nonnucleoside Reverse Transcriptase Inhibitors. Antimicrob. Agents Chemother. 50:351-4.
4. Vora, S., A. G. Marcelin, H. F. Gunthard, P. Flandre, H. H. Hirsch, B. Masquelier, A. Zinkernagel, G. Peytavin, V. Calvez, L. Perrin, and S. Yerly. (2006). Clinical validation of atazanavir/ritonavir genotypic resistance score in protease inhibitor-experienced patients. Aids 20:35-40.

1. Delaugerre C, Roudiere L, Peytavin G, Rouzioux C, Viard JP, Chaix ML (2005). Selection of a rare resistance profile in an HIV-1-infected patient exhibiting a failure to an antiretroviral regimen including tenofovir DF. J Clin Virol. 2005 Mar; 32(3): 241-4.
2. L Ross, P Gerondelis, Q Liao, B Wine, M Lim, M Shaefer, A Rodriguez, K Limoli, W Huang, NT Parkin, J Gallant, R Lanier (2005). Selection of the HIV-1 Reverse Transcriptase Mutation K70E in Antiretroviral-Naive Subjects Treated with Tenofovir/Abacavir/Lamivudine Therapy. [abstract 92] Antivir. Ther. Volume 10:S102
3. R Camacho, AR Godinho, P Gomes, A Abecasis, A-M Vandamme, C Palma, AP Carvalho, J Cabanas, K Goncalves (2005). Different substitutions under drug pressure at protease codon 82 in HIV-1 subtype G compared to subtype B infected individuals including a novel I82M resistance mutation. [abstract 138] Antivir. Ther. Volume 10:S151

1. Eoin Coakley, M Mass, and N Parkin (2005). Atazanavir Resistance in a Protease Inhibitor-nave Patient Treated with Atazanavir/Ritonavir Associated with Development of High-level Atazanavir Resistance and the N88S Mutation in Protease. [abstract 716] Conference on Retroviruses and Opportunistic Infections, Boston, MA.

1. Soo-Yon Rhee, Tommy Liu, Jaideep Ravela, Matthew J. Gonzales and Robert W. Shafer (2004). Distribution of Human Immunodeficiency Virus Type 1 Protease and Reverse Transcriptase Mutation Patterns in 4,183 Persons Undergoing Genotypic Resistance Testing. Antimicrobial Agents and Chemotherapy 48(8):3122-3126
2. Eoin Coakley, M Mass, and N Parkin (2005). Atazanavir Resistance in a Protease Inhibitor-nave Patient Treated with Atazanavir/Ritonavir Associated with Development of High-level Atazanavir Resistance and the N88S Mutation in Protease. [abstract 716] Conference on Retroviruses and Opportunistic Infections, Boston, MA.

1. Clevenbergh, P., R. Boulme, M. Kirstetter, and P. Dellamonica. 2004. Efficacy, safety and predictive factors of virological success of a boosted amprenavir-based salvage regimen in heavily antiretroviral-experienced HIV-1-infected patients. HIV Med 5:284-8.
2. Colonno, R., R. Rose, C. McLaren, A. Thiry, N. Parkin, and J. Friborg. 2004. Identification of I50L as the signature atazanavir (ATV)-resistance mutation in treatment-naive HIV-1-infected patients receiving ATV-containing regimens. J. Infect. Dis. 189:1802-10.
3. Colonno, R. J., A. Thiry, K. Limoli, and N. Parkin. 2003. Activities of Atazanavir (BMS-232632) against a Large Panel of Human Immunodeficiency Virus Type 1 Clinical Isolates Resistant to One or More Approved Protease Inhibitors. Antimicrob. Agents. Chemother. 47:1324-33.
4. Johnston, E., M. A. Winters, S. Y. Rhee, T. Merigan, C. A. Schiffer, and R. W. Shafer. 2004. A novel HIV-1 protease substrate-cleft mutation, L23I: Association with protease inhibitor therapy and in vitro resistance. Antimicrob Agents Chemother (In press).
5. Marcelin, A. G., C. Lamotte, C. Delaugerre, N. Ktorza, H. Ait Mohand, R. Cacace, M. Bonmarchand, M. Wirden, A. Simon, P. Bossi, F. Bricaire, D. Costagliola, C. Katlama, G. Peytavin, and V. Calvez. 2003. Genotypic inhibitory quotient as predictor of virological response to ritonavir-amprenavir in human immunodeficiency virus type 1 protease inhibitor-experienced patients. Antimicrob. Agents. Chemother. 47:594-600.
6. Mo, H., N. Parkin, K. Stewart, L. Lu, T. Dekhtyar, D. Kempf, and A. Molla. 2003. I84A and I84C mutations in protease confer high-level resistance to protease inhibitors and impair replication capacity Antivir. Ther. Volume 8:S56.
7. Parkin, N., C. Petropoulos, C. Chappey, J. Friend, T. Liegler, J. Martin, and S. Deeks. 2004. Isolated lopinavir resistance after virological rebound of a lopinavir/ritonavir-based regimen Antivir. Ther. Volume 9:S79.
8. Parkin, N. T., C. Chappey, and C. J. Petropoulos. 2003. Improving lopinavir genotype algorithm through phenotype correlations: novel mutation patterns and amprenavir cross-resistance. AIDS 17:955-61.
9. Rhee SY, Liu T, Ravela J, Gonzales MJ and Shafer RW. 2004. Distribution of human immunodeficiency virus type 1 protease and reverse transcriptase mutation patterns in 4,183 persons undergoing genotypic resistance testing. Antimicrob Agents Chemother 48:3122-6
10. Yerly, S., S. Vora, H. Günthard, P. Vernazza, H. Furrer, A. Zinkernagel, B. Hirschel, L. Perrin, and t. S. H. C. S. (SHCS). 2004. Virological response following switch to atazanavir/ritonavir in relation to baseline genotypic resistance pattern Antivir. Ther. Volume 9:S165
11. Genotype-phenotype correlations in Stanford HIVRT&PrDB

1. Brun-Vezinet, F., D. Descamps, A. Ruffault, B. Masquelier, V. Calvez, G. Peytavin, F. Telles, L. Morand-Joubert, J. L. Meynard, M. Vray, and D. Costagliola. 2003. Clinically relevant interpretation of genotype for resistance to abacavir. AIDS 17:1795-1802.
2. De Luca, A., M. Vendittelli, F. Baldini, S. Di Giambenedetto, M. P. Trotta, A. Cingolani, A. Bacarelli, C. Gori, C. F. Perno, A. Antinori, and G. Ulivi. 2004. Construction, training and clinical validation of an interpretation system for genotypic HIV-1 drug resistance based on fuzzy rules revised by virological outcomes. Antivir. Ther. 9:583-93.
3. Elion, R., C. Cohen, E. DeJesus, R. Redfield, J. Gathe, R. Hsu, L. Yau, L. Ross, B. Ha, E. Lanier, and T. Scott. 2004. COL40263: Resistance and efficiacy of once-daily trizivir and tenofovir DF in antiretroviral naive subjects [abstract 53]. 11th Conference on Retroviruses and Opportunistic Infections, San Francisco, CA.
4. Lanier, E., M. Ait-Khaled, J. Scott, C. Stone, T. Melby, G. Sturge, M. St Clair, H. Steel, S. Hetherington, G. Pearce, B. Spreen, and S. Lafon. 2004. Antiviral efficacy of abacavir in antiretroviral-therapy experienced adults harbouring HIV-1 with specific patterns of resistance to nucleoside reverse transcriptase inhibitors. Antivir. Ther. 9:37-45.
5. Lanier, E., D. Irlbeck, L. Ross, P. Gerondelis, M. R. Underwood, N. Parkin, C. Chappey, and M. St Clair. 2003. Prediction of NRTI options by linking RT genotype and phenotype breakpoings [abstract 586]. 10th Conference on Retroviruses and Opportunistic Infections, Boston, MA.
6. Marcelin, A., P. Flandre, J. Pavie, N. Schmidely, M. Wirden, O. Lada, D. Chiche, M. Bernard, J. Molina, and V. Calvez. 2004. New genotypic score comprising mutations impacting negatively and positively the virological response to didanosine in treatment-experienced patients from the randomized didanosine add on Jaguar study Antivir. Ther. Volume 9:S146.
7. Masquelier, B., E. Race, C. Tamalet, D. Descamps, J. Izopet, C. Buffet-Janvresse, A. Ruffault, A. S. Mohammed, J. Cottalorda, A. Schmuck, V. Calvez, E. Dam, H. Fleury, and F. Brun-Vezinet. 2001. Genotypic and phenotypic resistance patterns of human immunodeficiency virus type 1 variants with insertions or deletions in the reverse transcriptase (RT): multicenter study of patients treated with RT inhibitors. Antimicrob. Agents. Chemother. 45:1836-42.
8. Masquelier, B., C. Tamalet, B. Montes, D. Descamps, G. Peytavin, L. Bocket, M. Wirden, J. Izopet, V. Schneider, V. Ferre, A. Ruffault, P. Palmer, A. Trylesinski, M. Miller, F. Brun-Vezinet, and D. Costagliola. 2004. Genotypic determinants of the virological response to tenofovir disoproxil fumarate in nucleoside reverse transcriptase inhibitor-experienced patients. Antivir. Ther. 9:315-23.
9. Miller, M. D., N. Margot, B. Lu, L. Zhong, S. S. Chen, A. Cheng, and M. Wulfsohn. 2004. Genotypic and phenotypic predictors of the magnitude of response to tenofovir disoproxil fumarate treatment in antiretroviral-experienced patients. J. Infect. Dis. 189:837-46.
10. Rhee SY, Liu T, Ravela J, Gonzales MJ and Shafer RW. 2004. Distribution of human immunodeficiency virus type 1 protease and reverse transcriptase mutation patterns in 4,183 persons undergoing genotypic resistance testing. Antimicrob Agents Chemother 48:3122-6
11. Violin, M., A. Cozzi-Lepri, R. Velleca, A. Vincenti, S. D'Elia, F. Chiodo, F. Ghinelli, A. Bertoli, A. d'Arminio Monforte, C. F. Perno, M. Moroni, and C. Balotta. 2004. Risk of failure in patients with 215 HIV-1 revertants starting their first thymidine analog-containing highly active antiretroviral therapy. AIDS 18:227-35.
12. Whitcomb, J. M., N. T. Parkin, C. Chappey, N. S. Hellmann, and C. J. Petropoulos. 2003. Broad nucleoside reverse-transcriptase inhibitor cross-resistance in human immunodeficiency virus type 1 clinical isolates. J. Infect. Dis. 188:992-1000.
13. Winters, M. A., K. L. Coolley, P. Cheng, Y. A. Girard, H. Hamdan, L. C. Kovari, and T. C. Merigan. 2000. Genotypic, phenotypic, and modeling studies of a deletion in the beta3- beta4 region of the human immunodeficiency virus type 1 reverse transcriptase gene that is associated with resistance to nucleoside reverse transcriptase inhibitors. J. Virol. 74:10707-13.
14. Genotype-phenotype correlations in Stanford HIVRT&PrDB

1. Rhee SY, Liu T, Ravela J, Gonzales MJ and Shafer RW. 2004. Distribution of human immunodeficiency virus type 1 protease and reverse transcriptase mutation patterns in 4,183 persons undergoing genotypic resistance testing. Antimicrob Agents Chemother 48:3122-6
2. Genotype-phenotype correlations in Stanford HIVRT&PrDB

1. Molina, J. M., G. Marcelin, J. Pavie, C. Merle, M. Troccaz, G. Leleu, and V. Calvez. (2003). Didanosine (ddI) in treatment experienced HIV-infected patients: results from a randomized double-blind study. (AI454-176 Jaguar) [Abstract H-447]. 43rd Interscience Conference on Antimicrobial Agents and Chemotherapy. Chicago, IL.

1. Gallant J, Rodriguez AE, Weinberg W. (2003). Early non-response to tenofovir DF (TDF) + abacavir (ABC) and lamivudine (3TC) in a randomized trial compared to efavirenz (EFV) + ABC and 3TC: ESS30009 [Abstract 1722a].43rd Interscience Conference on Antimicrobial Agents and Chemotherapy. Chicago, IL.

• The Protease Resistance Notes page was updated; position 47 is now responsible for Intermediate Resistance to LPV, instead of Contributing to Resistance.
• Many scores were updated for Protease and RT, and a new Protease drug was added, ATV.

1. Colonno (2000).
2. Colonno (2002).
3. Colonno (2003).
4. Gong (2000).

1. Harrigan (2003).
2. Kagan (2003).
3. Mo (2003).
4. Parkin (2003). Garcia-Lerma (2003).

• Comments were added to the HIVDB algorithm to include RT positions 238 and 333. In addition comments for protease positions 20, 32, 46, 47, 54, 63, and 82, and RT positions 65, 74, 98, 101, 103, 151, 184, and 215 were updated.
• The default font for the reports has been increased for improved readability.

• Mutations at RT position 238 are now classified as resistance mutations
• RT mutation V106M now has a comment describing its involvement in NNRTI resistance, and is no longer classified as an 'atypical' mutation
• The default setting for the programs is now the mutation input form, rather than the sequence input form.

1. Brenner, B, et al. (2003).

1. Parkin, NT, et al. (2003).

• The results of subtyping analysis by reference sequence comparison are now rounded to one decimal point, rather than the integer value.
• RT mutations V179I and A98S are no longer classified as resistance mutations
• V179I is no longer classified as an atypical mutation
• If no sequence identifier is provided but the file uploaded feature has been used, the sequence name becomes the name of the submitted file
• General comments are now sorted by position number