Stanford University HIV Drug Resistance Database - A curated public database designed to represent, store, and analyze the divergent forms of data underlying HIV drug resistance.

Sequence Analysis Programs

Table of Contents

 
version 7.0, 2014-02-27
  1. Scores
          Tab-Delimited Files
                Individual Scores:      NRTI   |   NNRTI   |   PI   |   INI
                Combination Scores: NRTI   |   NNRTI   |   PI   |   INI
          Sortable Pages
                NRTI   |   NNRTI   |   PI   |   INI
  2. Comments
          The list of comments that appear whenever a mutation is present in a sequence.
          Tab-Delimited Files
                NRTI & NNRTI   |   PI   |   INI
          Web Pages
                NRTI   |   NNRTI   |   PI   |   INI
  3. Notes
          An expanded version of the comments with references supporting the scores.
          NRTI   |   NNRTI   |   PI   |   INI
  4. Comparisons
          Changes from the previous version to the current one and a spreadsheet with DRM Patterns and their scores.
          NRTI   |   NNRTI   |   PI   |   INI
  5. Interpretation for distinct Patterns of Drug Resistance Mutation (DRM) in published sequences.
          NRTI   |   NNRTI   |   PI   |   INI
 
version 6.3.1, 2013-09-20

A single change was made the scoring of RPV. No changes were made to the rest of the scoring of PI, NRTI, or INI drug mutations. Our latest scoring information is available at this link.

NNRTI score change
MutationRPV
OldNew
138A515

Relevant references:
  • Haddad, M., Napolitano, L., Paquet, A., Evans, M., Petropoulos, C.J., Whitcomb, J., Huang, W (2011). Mutation Y188L of HIV-1 reverse transciptase is strongly associated with reduced susceptibility to rilpivirine. .
 
version 6.3.0, 2013-06-05

Many changes were made to the INI, NRTI, and NNRTI drug-resistance mutation scores as well as INI, NRTI, and NNRTI comments. The score changes to the INI, NRTI, and NNRTI drugs are detailed in the following three tables. Scores for dolutegravir (DTG) are introduced in this version and they can also be found in the same link as above to INI, NRTI, and NNRTI drug-resistance mutation scores.

INI score changes
MutationRALEVGDTG
OldNewOldNew
51Y01510
66I0100
66K156010
74M5105105
92G01503010
97A5105105
125K50500
143H30450
143K0450
147G45600
151A5155300
151L03006015
153F01010
155S15300
155T0300300
163K5100100
163R5100100
230R0100100
263K010152010
INI combination scores (all new)
CombinationDTG
148HRK +140SAC20
148HRK +138AK20
148HRK +74M5
148HRK +97A5
148HRK +163RK5

NNRTI score changes
MutationEFVNVPETRRPV
OldNewOldNewOldNewOldNew
90I5050
100I3045304515301530
100V030015010015
101E1030
101P30603045
103S3045
138A5050
179D105105
179L0005
181F015060015015
181G015060015015
181S3060
188C1560
188F060030030
188H1530
188L1015
190A4045
190E15451545
190Q15451545
221Y5050
227L0151530
230I015030015030
238N010
NNRTI combination scores (changes are emboldened)
CombinationEFVNVPETRRPV
OldNewOldNewOldNewOldNew
101E +184I030
103R +179D5202020
103R +179E0505
106A +227L1515
106I +179D55550505
106I +181C0505
138K +184I030
181C +190ASCVT15101510
181IV +190EQ150150
181C +190EQ150150
181IV +190ASCVT150150
181C +221Y05
181CIV +179F15151515
90I +181C0505

NRTI score changes
Mutation3TCFTCABCAZTD4TDDITDF
OldNewOldNewOldNewOldNewOldNewOldNewOldNew
40F0505
65N0-10153015301530
65R4560-10-15304545604560
66delete15301530153015301530
67EG15101510
67delete15301530153015301530
68delete15301530153015301530
69G1010100105
69delete150
70R0505
70GE0152515
70delete150
71delete150
74I2030
74V-100
75L010010
75A15101510
75M60403015
75S2010
75T015
75I050510510505
77L105105105105
116Y105105105105
118I0505
210W1515510
215CDEIVS510
215NAL510510510
219D501001005050
219H501001005050
NRTI combination scores (changes are emboldened)
Combination3TCFTCABCAZTD4TDDITDF
OldNewOldNewOldNewOldNewOldNewOldNewOldNew
184VI +74VI2015
65R +151M1015
65R +115F1015
65R +62V010
65R +151M015
65R +184VI010010
65N +184VI010010
70EG +184VI010010
210W +215FY10101010101010101010
41L +210W10101010101010101010
41L +215FY10101010101010101010
67NG +70R +219QENR010010010010010
210W +215SCDEIVNAL5555555555
41L +215SCDEIVNAL5555555555
40F +41L +215FY05050505050505
44AD +41L +215FY05050505050505
V118I +41L +215FY05050505050505

As in the previous update, we have made the effect of these changes transparent by including an excel spreadsheet with the following data: (i) unique mutation patterns from HIV-1 RT sequences from >40,000 persons, (ii) the calculated estimate of susceptibility to each ARV of a class, (iii) the changes from the previous version of the algorithm to the current version. The INI, NRTI, and NNRTI spreadsheets have 105, 2,592, and 1,085 unique patterns of scored mutations, respectively.

Each spreadsheet has two worksheets:

  • "Score Changes By Drug" shows only the patterns where there is a difference in score; for example, in the NNRTI spreadsheet, Rilpivirine (RPV) shows 271 rows indicating that the score of 814 drug resistance mutation patterns was left unchanged. More importantly, each row shows a mutation pattern with details on what the difference in scores is and what caused it; for example the first RPV row in the worksheet (shown below) shows the drug resistance mutation pattern "179D" a) occuring 528 times in our database, b) scoring 5 points, putting it in the lowest resistance category, "Susceptible (1)", a one level decrease from "Potential low-level resistance (2)" with a score of 10, and c) changing in levels because mutation 179D now scores 5 points.
    DRMPatternCountDrugOld version levelNew version levelLevel differenceOld version scoreNew version scoreNew Scores
    179D528RPV21-1105V179D(5)
  • "Mutation Patterns" in the other hand shows all patterns in decreasing order of frequency with old (prefix 'o') and new (prefix 'n') drug intepretation levels.

 
version 6.2.0, 2012-05-29

Many changes were made to the NRTI and NNRTI drug-resistance mutation scores. Many NRTI, NNRTI, and PI comments were also updated.

We have made the effect of these changes transparent by including an excel spreadsheet with the following data: (i) unique mutation patterns from HIV-1 RT sequences from >40,000 persons, (ii) the calculated estimate of susceptibility to each ARV of a class, (iii) the changes from the previous version of the algorithm to the current version. The NRTI and NNRTI spreadsheets have 2,081 and 1,104 unique patterns of scored mutations.

Each spreadsheet has two worksheets:

  • "Score Changes By Drug" shows only the patterns where there is a difference in score; for example, in the NNRTI spreadsheet, Rilpivirine (RPV) shows 192 rows indicating that the score of 912 drug resistance mutation patterns was left unchanged. More importantly, each row shows a mutation pattern with details on what the difference in scores is and what caused it; for example the first RPV row in the worksheet (shown below) shows the drug resistance mutation pattern "188L" a) occuring 129 times in our database, b) scoring 60 points, putting it in the highest resistance category, "High-level resistance (5)", a three level increase from "Potential low-level resistance (2)" with a score of 10, and c) changing in levels because mutation 188L increased by 50 points.
    DRMPatternCountDrugOld version levelNew version levelOld version scoreNew version scoreLevel differenceScore differences responsible for change
    188L129RPV2510603Y188L 50
  • "Mutation Patterns" in the other hand shows all patterns in decreasing order of frequency with old (prefix 'o') and new (prefix 'n') drug intepretation levels.

 
version 6.1.1, 2011-11-30
Extensive changes were made to the scoring of PI drug mutations; almost all individual scores were updated and combination scores were added. No changes were made to the scoring of RTI or INI drug mutations. As usual, our latest scoring information is available at this link.

Lastly, almost all PI comments were updated. As usual, our latest comment information is available at this link;

 
version 6.1.0, 2011-10-10

Scores for rilpivirine (RPV) have been added and scores for delavirdine (DLV) are no longer available in our interpretation programs.
As usual, our latest scoring information is available at this link; but we are also making available a copy of the last version of files with scores and/or comments for DLV in various formats: tab-delimited scores, and tab-delimited comments, and XML (which you can use to compare against other algorithms in HIValg).

NNRTI score changes
MutationsEFVNVPETR
OldNewOldNewOldNew
98G1015
100I403040302015
101P403040602030
101H510
101N10015050
103N50
103R5050
103S50
103T603050
103H030060
106A50
106M100
108I105
138K10151015
138Q1015
138G515
179F1553010
181C3530
181I4560
181V4560
181S301560302015
188C100
188H100
221Y050505
225H100
227L5050
230L45302530
234I100100100
238N1503010
318F100
348I015


DrugsOld RuleNew Rule
EFV(K103R AND V179D) => 5*
(V106I AND V179D) => 5*
NVP(K103R AND V179D) => 10*
(V106I AND V179D) => 10*
RPV(Y181CIV AND V179F) => 20*
(Y181CIV AND G190ASEQ) => 15*
*The combination scores are an additional penalty to be added to the individual scores for each mutation.

Lastly, almost all NNRTI comments were updated. As usual, our latest comment information is available at this link;

 
version 6.0.12, 2011-09-19
No scores or comments were updated for any drugs.

However some basic sequence processing steps including translation were modified to better reflect current agreement:
  • question mark '?' is now an accepted nucleotide, it is replaced with an 'N'; it used to be deleted
  • dashes '-'s and tildes '~'s in the middle of a sequence are now deleted, so the alignment program can then insert a gap and a deletion reported; a dash '-' used to be replaced with an 'N' and a tilde '~' deleted.
  • if a triplet codon has an 'N' and it can be translated into multiple amino acids, it just translates to an X; it used to translate to whatever the AA mixture was unless it was >4 then it translated to an X.
    For example, 'AAN' translates to 'X', it used to translate to 'KN'. An 'N' is likely to identifiy an unknown base and do not want the AA mixture to affect the resistance scoring, prevalence calculations, or identifying hypermutated sequences. Our translation depends on a text file which I am providing in both the new version and the older version for your comparison.
  • codon positions with ambiguous bases are flagged even if it is a silent mutation. Previously we only flagged those ambiguous bases that led to a mutation.
    For example, 'TCN' at position 147 in integrase translates to the consensus AA Serine so it will appear in the ambiguous row in the Quality portion of the report but will be missing from the resistance mutations portion.
 
version 6.0.11, 2011-03-29
Protease classification changes
'PI Minor' -> 'PI Major''PI Major' -> 'Other''PI Major' -> 'PI Minor''PI Minor' -> 'Other'
48ASTQ
48L*
90 NOT M 23I
24I
30 NOT N
32 NOT I
33F
47 NOT AV
50 NOT LV
53L
54 NOT ALMSTV
82 NOT ATIFLMSC
84 NOT ACV
88D
23 NOT I
24F
53 NOT LY
74S
83 NOT D
85V
88 NOT DGST
*a new rare mutation comment was added to 48L

RTI classification changes
'Other' -> 'NRTI''Other' -> 'NNRTI''NRTI' -> 'Other''NNRTI' -> 'Other'
184 NOT IV 188 NOT CHLF 41 NOT L
44AD
65 NOT NR
77 NOT L
115 NOT F
116 NOT Y
118I
151 NOT LM
210FS
210 NOT FSW
219DH
219 NOT ENQRWDH
348 NOT I
90I
101 NOT EHNPQR
103EQ
103R
103 NOT EHNQRST
106I
106L
106 NOT AIML
108 NOT I
138A
138G
138Q
138 NOT AGKQ
179T
179 NOT DEFIT
190 NOT ACEQSTV
221Y
221 NOT Y
225 NOT H
227 NOT CL
230 NOT L
234 NOT I
236 NOT L
238 NOT NRT

Integrase classification changes
'INI Minor' -> 'Other'
230N


Protease score changes
MutationsDrugsOldNew
48EIDV/r50
NFV15
SQV/r30
LPV/r5
ATV/r5
48LIDV/r05
NFV15
SQV/r30
LPV/r5
ATV/r5
 
version 6.0.10, 2011-01-20
Comment on unusual mutations at integrase position 72 is no longer triggered by I72V.
The latest algorithm XML files can be found in the algorithms page and the latest comments file can be found in the comments section of the Release Notes.
 
version 6.0.9, 2010-08-24
the following PI mutation scores were updated
MutationsDrugsOldNew
11IDRV/r54
33F54
46ILV20
54STVA20
82F210
82ML20
89V54
90M20
54VTPV/r155
58E1510
74P1510
82A60
83D1510

Integrase comments were updated. link to updated comments

Relevant references:
  • Talbot A, Grant P, Taylor J, Baril JG, Liu TF, Charest H, Brenner B, Roger M, Shafer R, Cantin R, Zolopa A (2010). Predicting tipranavir and darunavir resistance using genotypic, phenotypic, and virtual phenotypic resistance patterns: an independent cohort analysis of clinical isolates highly resistant to all other protease inhibitors. Antimicrob Agents Chemother. 54(6):2473-9.
  • Rhee SY, Taylor J, Fessel WJ, Kaufman D, Towner W, Troia P, Ruane P, Hellinger J, Shirvani V, Zolopa A, Shafer RW (2010). HIV-1 Protease Mutations and Protease Inhibitor Cross Resistance. Antimicrob Agents Chemother. [in press]
 
version 6.0.8, 2010-04-22
the following NNRTI mutation scores were updated
MutationsDrugsOldNew
101EETR1510
103NST105
179F2515
181IV3545
188H1510
188L20
190AQS1510
190E25
230L2025

DrugsOld RuleNew Rule
ETRN/A(179F AND 181CIV) => 20*
ETRN/A(190ASEQ AND 181CIV) => 15*
*The combination scores are an additional penalty to be added to the individual scores for each mutation.


the following NRTI mutation scores were updated
MutationsDrugsOldNew
65RABC3040
DDI3040
TDF4045
115FTDF1015

DrugsOld RuleNew Rule
ABC(184V AND 65R) => 20(184VI AND 65R) => 20*
(184V AND 74V) => 20(184VI AND 74VI) => 20*
DDIN/A(184VI AND 65R) => 20*
N/A(184VI AND 74VI) => 20*
TDFN/A(115F AND 65R) => 15*
N/A(151M AND 65R) => 15*
N/A(70E AND 65R) => 15*
*The combination scores are an additional penalty to be added to the individual scores for each mutation.
 
version 6.0.7, 2009-12-28
the following PI mutation scores were updated
MutationsDrugsOldNew
46ILDRV/r, TPV/r42
47VADRV/r1210
54STVDRV/r42
ADRV/r32
73STCADRV/r20
74PDRV/r52
76VIDV/r, LPV/r2025
82ASTCDRV/r30
FDRV/r62
TPV/r60
MLDRV/r32
90MDRV/r, TPV/r62

the following NRTI mutation score was updated
(184V AND 115F)*ABC020
*The combination scores are an additional penalty
to be added to the individual scores for each mutation.

Relevant references:
  • Talbot A, Grant P, Taylor J, Baril J-G, Charest H, Liu T, Brenner B, Roger M, Shafer R, Cantin R, Zolopa A (2009). Genotypic, phenotypic and virtual phenotypic resistance patterns for tipranavir (TPV) and darunavir (DRV): an independent analysis of a Quebec HIV-1 cohort highly resistant to all other protease inhibitors. [Abstract WEPEB202] 5th IAS Conference on HIV Pathogenesis, Treatment and Prevention; Cape Town, South Africa.
  • Rhee S-Y, Horberg M, Follansbee S, Hurley L, Liu T, Klein D, Fessel WF, Shafer RW (2009). Virologic Response to Raltegravir (RAL) Salvage and Maintenance Therapy. 47th Annual Meeting of the Infectious Diseases Society of America; Philadelphia, PA.
  • Nijhuis M, Wensing AM, Bierman WF, de Jong D, Kagan R, Fun A, Jaspers CA, Schurink KA, van Agtmael MA, Boucher CA (2009). Failure of treatment with first-line lopinavir boosted with ritonavir can be explained by novel resistance pathways with protease mutation 76V. J Infect Dis 200(5):698-709.
  • Arastéh K, Yeni P, Pozniak A, Grinsztejn B, Jayaweera D, Roberts A, Hoy J, De Meyer S, Vangeneugden T, Tomaka F (2009). Efficacy and safety of darunavir/ritonavir in treatment-experienced HIV type-1 patients in the POWER 1, 2 and 3 trials at week 96. Antivir Ther 14(6):859-64.
  • Van Marck H, Dierynck I, Kraus G, Hallenberger S, Pattery T, Muyldermans G, Geeraert L, Borozdina L, Bonesteel R, Aston C, Shaw E, Chen Q, Martinez C, Koka V, Lee J, Chi E, de Béthune MP, Hertogs K (2009). The impact of individual human immunodeficiency virus type 1 protease mutations on drug susceptibility is highly influenced by complex interactions with the background protease sequence. J Virol 83(18):9512-20. Epub 2009 Jul 8.
  • Lefebvre E, Schiffer CA (2008). Resilience to resistance of HIV-1 protease inhibitors: profile of darunavir. AIDS Rev 10(3):131-42.
  • McKinnell JA, Lin HY, Nevin CN, Willig JH, McFarland G, Genz M, Raper JL, DeLaitsch LL, Mrus JM, Klaskala W, Mugavero MJ, Saag MS (2009). Early virologic suppression with three-class experienced patients: 24-week effectiveness in the darunavir outcomes study. AIDS 23(12):1539-46.
  • De Meyer S, Lathouwers E, Dierynck I, De Paepe E, Van Baelen B, Vangeneugden T, Spinosa-Guzman S, Lefebvre E, Picchio G, de Béthune MP (2009). Characterization of virologic failure patients on darunavir/ritonavir in treatment-experienced patients. AIDS 23(14):1829-40.
 
version 6.0.5, 2009-10-15
the following NRTI mutation scores were updated
MutationsDrugsOldNew
115FABC2530
(184V AND 74V)*020
(184V AND 65R)*020
*The combination scores are an additional penalty to be added to the individual scores for each mutation.
For example, a sequence with mutations 184V and 74V will have a total score of 62 for ABC (High-level resistance); resulting from adding 12 for M184V, 30 for L74V, and 20 for having both 184V and 74V

added comment for protease 69 deletion.
 
version 6.0.4, 2009-10-15
  • If an insertion falls in the RT gene between positions 66 and 70 (inclusive), we force it to position 69 to trigger its scoring. In the example below, the original alignment of the sequence has the insertion AAGTAG at aa position 67. This an excerpt from the original alignment (the query nucleotide sequence is on top and the reference amino acid at the bottom)
       180     .    :    .    :    .    :    .    :    .    :    .    :
       482 TTTGCTATAAAGAAAAAAGAAAGTAGTAGTGGTAAATGAAGAAAATTAGTAGATTTCAGA
           ::::::::::::::::::..------.:::  .:::.. :::::::::::::::::::::
        61 PheAlaIleLysLysLysAs      pSerThrLysTrpArgLysLeuValAspPheArg
    
    we then force the insertion in-frame and to aa position 69 as AGTGGT
       180     .    :    .    :    .    :    .    :    .    :    .    :
       482 TTTGCTATAAAGAAAAAAGAAAGTAGTAGTGGTAAATGAAGAAAATTAGTAGATTTCAGA
           ::::::::::::::::::.. :::   ------:::.. :::::::::::::::::::::
        61 PheAlaIleLysLysLysAspSerThr      LysTrpArgLysLeuValAspPheArg
    	                          ^ this is now the insertion at aa 69
    
    We are basically reversing a change introduced in version 6.0.1 to avoid changing the original nucleotide sequence.
 
version 6.0.3, 2009-09-01
  • vastly updated all integrase comments
added scores for integrase drugs: raltegravir (RAL) and elvitegravir (EVG)
MutationRALEVG
51Y015
66I060
66A/K1560
74M55
92Q/V3060
95K55
97A55
114Y05
121Y3030
125K55
128T05
138K/A1515
140S/A/C3030
143C/R600
143H300
145S060
146P030
147G045
148H/K/R6060
151I/A55
153Y015
155H6060
155S1530
157Q1010
163R/K50
263K015
 
version 6.0.2, 2009-07-10
  • Corrected the comments for RT mutations 74I and 74V
  • If an insertion is out-of-frame, we force it to be in-frame. In the made-up example below, where the sequence has the insertion AAGTAG at aa position 37
    the new version now has an mutation (E) at position 37 since the codon is now GAA instead of GAT (D).
    This an excerpt from the original alignment (the query nucleotide sequence is on top and the reference amino acid at the bottom)
        90     .    :    .    :    .    :    .    :    .    :    .    :
       392 TTTGCTATAAAGAAAAAAGAAAGTAGTAGTGGTAAATGAAGAAAATTAGTAGATTTCAGA
           ::::::::::::::::::..------.:::  .:::.. :::::::::::::::::::::
        31 PheAlaIleLysLysLysAs      pSerThrLysTrpArgLysLeuValAspPheArg
    
        90     .    :    .    :    .    :    .    :    .    :    .    :
       392 TTTGCTATAAAGAAAAAAGAAAGTAGTAGTGGTAAATGAAGAAAATTAGTAGATTTCAGA
           ::::::::::::::::::   ------:::  .:::.. :::::::::::::::::::::
        31 PheAlaIleLysLysLysAsp      SerThrLysTrpArgLysLeuValAspPheArg
    
 
version 6.0.1, 2009-05-06
  • We now flag every problem and potential problem at a codon. For instance, the mutation K64KMRT (codon ANG) is now flagged as having a highly ambiguous nucleotide (K64N) and resulting in atypical mutations (K64T and K64M) . A second case shows that E89*EKQ is now flagged ambiguous, atypical, and having a stop codon .
  • Only valid mutations are used for classifying a mutation - ignoring Xs and stop codons (*). For instance, E138X and Q151*Q are now classified as OTHER whereas before they were classified as NNRTI and NRTI mutations, respectively.
  • Multiple frameshifts are now properly delimited. Frameshifts are only used for flagging possible QA problems and not used for interpretation scoring or comments.
  • List the mutation and insertion when both are found at the same position. For instance, if we have a mutation F and an insertion at position 215 we indicate this with T215Fi whereas before we would not have shown the mutation and just shown the insertion with T215i.
    The mutation present at the insertion position can also be a mixture. For instance, K13QRi indicates an insertion at position 13 along with the mutation "QR" which is coded by "CRG" representing "CAG" and "CGG".
  • Insertion information is now more complete and accurate.
  • If an insertion falls in the RT gene between positions 66 and 71 (inclusive), we force it to position 69 to trigger its scoring. In the example below, where the sequence has the insertion AAGTAG at aa position 67, the new version only has an insertion at position 69 whereas the previous version also has a mutation (D67E) with its associated comment and penalty scores for ABC, AZT, D4T, and DDI

    This an excerpt from the original alignment (the query nucleotide sequence is on top and the reference amino acid at the bottom)
       180     .    :    .    :    .    :    .    :    .    :    .    :
       482 TTTGCTATAAAGAAAAAAGAAAGTAGTAGTGGTAAATGAAGAAAATTAGTAGATTTCAGA
           ::::::::::::::::::..------.:::  .:::.. :::::::::::::::::::::
        61 PheAlaIleLysLysLysAs      pSerThrLysTrpArgLysLeuValAspPheArg
    
    the new version simply uses this alignment and reports the insertion AAGTAG to be at position 69
       180     .    :    .    :    .    :    .    :    .    :    .    :
       482 TTTGCTATAAAGAAAAAAGATAGTGGTAAGTAGAAATGAAGAAAATTAGTAGATTTCAGA
           ::::::::::::::::::...:::  .------:::.. :::::::::::::::::::::
        61 PheAlaIleLysLysLysAspSerThr      LysTrpArgLysLeuValAspPheArg
    	                          ^ this is now the insertion at aa 69
    
 
version 6.0, 2009-05-06
We have adopted a new compiler for the Algorithm Specification Interface (ASI). In the process of making this upgrade we have further standardized our approach to handling sequences with quality control problems. The new compiler will provide more flexibility for encoding algorithms. It will also make it possible for Sierra to accept algorithms in addition to HIVDB.
 
version 5.1.2, 2009-02-10
A few comment rules were updated.
Regarding the QA table, the rule for defining atypical mutations was revisited and updated: any mutation absent in the typical files including those at positions missing from the file (those with no typical mutations) are now included.
 
version 5.1.1, 2009-01-21
summary of NNRTI mutation scores as compared to the previous version
MutationsDLVEFVNVPETR
227Y0010 => 00

summary of NRTI mutation scores as compared to the previous version
Mutations3TCFTCABCAZTD4TDDITDF
215 (NOT CDEFISVY)0010 => 015 => 015 => 015 => 010 => 0
219T005 => 010 => 05 => 000

All comments were reviewed and updated extensively.
 
version 5.0.1, 2008-11-25
summary of NNRTI mutation scores as compared to the previous version
MutationsDLVEFVNVPETR
106A50306010 => 5
227L0 => 50 => 51510 => 5
 
version 5.0.0, 2008-11-04
summary of PI mutation scores as compared to the previous version
MutationsFPV/rIDV/rNFVSQV/rLPV/rATV/rTPV/rDRV/r
10F4444442 => 02
10I2222222 => 02 => 0
10R2222222 => 02 => 0
10V2222223 => 02 => 0
10Y2222222 => 02 => 0
11I4 => 52 => 02 => 02 => 02 => 02 => 02 => 04 => 5
23I001500000
24F1 => 01 => 01 => 01 => 01 => 01 => 01 => 01 => 0
24I2 => 352 => 32 => 32 => 32 => 30 => -22 => 0
30N0050 => 60000 => 1000
32A5 => 05 => 05 => 05 => 05 => 05 => 05 => 05 => 0
32I20 => 3010 => 125 => 105 => 010 => 1210 => 128 => 510 => 15
33F5 => 10000558 => 105
35G000 => 500020
43T0 => 20 => 20 => 20 => 20 => 20 => 22 => 50
46I121225 => 30512 => 1015 => 128 => 44
46L121225 => 30512 => 1015 => 128 => 44
46V10 => 510 => 520 => 10510 => 510 => 58 => 24 => 2
47A20 => 305 => 105 => 155 => 040 => 5055 => 1010
47V20 => 305 => 105 => 155 => 010 => 15510 => 1512 => 10
48A0515305500
48E00 => 50 => 150 => 300 => 50 => 500
48M51025 => 3050 => 60103000
48Q00 => 50 => 150 => 300 => 50 => 500
48S0515305500
48T0515305500
48V51025 => 3050 => 60103000
50L0 => -50 => -50 => -50 => -50 => -550 => 600 => -50 => -5
50V50 => 6005 => 100200-520
53L3333 => 1033 => 53 => 03 => 0
53Y2 => 0222222 => 02 => 0
54A1010 => 1210 => 1510 => 1510 => 1210 => 12154 => 3
54L15 => 301015101210 => 120 => -810 => 15
54M20 => 301015101210 => 125 => 1512 => 20
54S1010 => 121510 => 1510 => 1210 => 125 => 104
54T1010 => 121510 => 1510 => 1210 => 125 => 104
54V1010 => 1215151210 => 1210 => 154
58E005000 => 55 => 150
71I2222222 => 02 => 0
71L0 => 20 => 20 => 20 => 20 => 20 => 200
71T1 => 21 => 21 => 21 => 21 => 21 => 21 => 01 => 0
71V3 => 23 => 23 => 23 => 23 => 23 => 23 => 02 => 0
73A255 => 105 => 1025 => 1022
73C255 => 101025 => 1022
73S255 => 101025 => 1022
73T255 => 101025 => 1022
74P0 => 50 => 5102 => 50 => 50 => 510 => 155
74S001000000
76V12 => 3512 => 205-58 => 20-5-10 => -812 => 15
82A1035351020 => 251510 => 64 => 3
82C5 => 1010105 => 10105 => 1010 => 66 => 3
82F1035351020 => 252015 => 66
82L101010101010606 => 3
82M10151010101010 => 66 => 3
82S1035351020 => 2520156 => 3
82T1035351020 => 252030 => 406 => 3
83D00 => 50 => 50 => 500 => 510 => 150
84A3525 => 35404010 => 1525 => 3520 => 1512 => 10
84C25 => 3515 => 3525 => 4025 => 4010 => 1520 => 3520 => 1512 => 10
84V3525 => 3535 => 4035 => 4012 => 1525 => 3520 => 1512 => 10
88D0525 => 301001000
88G0525 => 305015 => 1000
88S-101040 => 605 => 10030 => 6000 => -5
88T0525 => 305015 => 1000
89V4 => 824 => 101 => 21 => 21 => 21 => 04 => 5
90M1520 => 3050 => 6035 => 40102066

summary of NNRTI mutation scores as compared to the previous version
MutationsDLVEFVNVPETR
98G5 => 105105
100I40404020
100V10 => 010 => 010 => 010 => 0
101E30153015
101H1510155
101N1510155
101P30 => 4030 => 4030 => 4015 => 20
101Q0 => 50 => 50 => 50 => 5
103E15 => 010 => 015 => 05 => 0
103N606070 => 6010
103Q10 => 010 => 010 => 05 => 0
103R5555 => 0
103S6050 => 606010
103T6050 => 606010
106A5025 => 306010
106L10 => 05 => 010 => 00
106M60606010
108I1010105 => 0
138A0 => 50 => 50 => 50 => 5
138G0 => 50 => 50 => 50 => 5
138K20 => 151020 => 1520 => 10
138Q0 => 100 => 100 => 100 => 10
179D10101010
179E10101010
179F30153040 => 25
179M10 => 010 => 010 => 010 => 0
181C6020 => 306030 => 35
181I6020 => 306030 => 35
181S30 => 6010 => 3030 => 6010 => 20
181V6020 => 306030 => 35
188C25 => 3025 => 306010
188H25 => 3025 => 3025 => 3015
188L30606020
190A0406015
190C0606020 => 10
190E15 => 30606030 => 25
190Q15 => 30606020 => 15
190S0606030 => 15
190T0606020 => 10
190V0606020 => 10
225H0 => 15300 => 1510
227C30153015
227L001510
227Y00100
230L6040 => 456020
234I10101010
236L60000
236S25 => 0000
238N3012 => 15300 => 5
238T3015300 => 5
318F50 => 6012 => 10300 => 10

Where appropriate, PI drugs were renamed to include '/r' - FPV/r, IDV/r, SQV/r, LPV/r, ATV/r, TPV/r, DRV/r - to explicitly indicate ritonavir boosting; this is explained more extensively in the Release Notes.

INI comments were added and most PI and NNRTI comments updated.

Relevant references:
Please find references and updated summary of the key mutations associated with each antiretroviral drug in the following PI and NNRTI drugs summary pages: ATV/r, DRV/r, fAPV/r, LPV/r, SQV/r, TPV/r, and ETR.
 
version 4.3.7, 2008-09-16
No scores or comments were updated for PI or NNRTI drugs. However a new gene - Integrase (IN) - was introduced with a partial report displaying: i) summary data, ii) sequence quality assessment, iii) mutations classified as Integrase Inhibitor (INI) Major Resistance Mutations or INI Minor Resistance Mutations, iv) drug resistance comments, and v) no drug resistance interpretation.
A clarifying update, with no effect in the drug scores, was also made to the xml file (explained in the Algorithm Specification Interface page) to explictly define the global range used to translate the total drug score to a level of inferred drug resistance (explained in this section of the Release Notes) so there are NO overlapping ranges.
 
version 4.3.6, 2008-05-02
the following PI mutation scores were updated
73STDRV52
74P05
82A64
54VTSA
46ILV

A few comments were updated.

Relevant reference:
  • Scherer J, Boucher CA, Baxter JD, Schapiro JM, Kohlbrenner VM, Hall DB (2007). Improving the prediction of virological response to tipranavir: the development of a tipranavir weighted score. [Poster P3.4/07] 11th European AIDS Conference; Madrid, Spain.
  • De Meyer S, Dierynck I, Lathouwers E, Baelen BV, Vangeneugden T, Spinosa-Guzman S, Picchio G, De Bethune M-P (2008). Identification of mutations predictive of a diminished response to darunavir/ritonavir: analysis of data from treatment-experienced patients in POWER 1, 2, 3 and DUET-1 and DUET-2. [Poster 54] 6th European HIV Drug Resistance Workshop; Budapest, Hungary
 
version 4.3.5, 2008-04-29
the following PI mutation scores were updated
89IFPV, NFV, DRV20
IDV, SQV, LPV, ATV, TPV10
89TFPV, NFV, DRV20
IDV, SQV, LPV, ATV, TPV10
82TTPV2530
82LTPV4060
76VTPV-5-10
48V/MATV2530

the following NNRTI mutation scores were updated
MutationDrugsScore
OldNew
234IDLV, EFV, NVP, ETR010

the following NRTI mutation scores were updated
MutationDrugsScore
OldNew
65RABC2530
74VDDI5560
75TDDI1020
D4T3050
75MDDI1020
D4T2030

A few comments were updated.

Relevant reference:
  • Rhee SY, Taylor J, Wadhera G, Ben-Hur A, Brutlag DL, Shafer RW (2006). Genotypic predictors of human immunodeficiency virus type 1 drug resistance. Proceedings of National Academy of Sciences of the United States of America Oct 25, 2006.
  • Scherer J, Boucher CA, Baxter JD, Schapiro JM, Kohlbrenner VM, Hall DB (2007). Improving the prediction of virological response to tipranavir: the development of a tipranavir weighted score. [Poster P3.4/07] 11th European AIDS Conference; Madrid, Spain.
  • Vermeiren H, Van Craenenbroeck E, Alen P, Bacheler L, Picchio G, Lecocq P; Virco Clinical Response Collaborative Team (2007).Prediction of HIV-1 drug susceptibility phenotype from the viral genotype using linear regression modeling. J Virol Methods 145(1):47-55. Epub 2007 Jun 15.
 
version 4.3.4, 2008-02-06
The abbreviation for the NNRTI drug Etravirine was changed from ETV to ETR, since ETV is commonly used to refer to the Hepatitis B Virus nucleoside Entecavir.
 
version 4.3.3, 2008-01-15
The XML underlying the HIVDB interpretation algorithm was corrected to have a score of zero when a negative-scoring mutation is in a mixture with a non-scored mutation (default score of zero); previously the negative score was observed in these cases.
 
version 4.3.2, 2008-01-08
the following PI mutation scores were updated
MutationDrugsScore
OldNew
24ITPV20
48V/MATV1025
54LTPV50
58ENFV05
TPV25
74PNFV, TPV210
74SNFV010
76VTPV0-5
83DTPV210
84VACTPV2520

the following NRTI mutation score was updated
MutationDrugsScore
OldNew
115FTDF010

Relevant reference:
  • Baxter JD, Schapiro JM, Boucher CA, Kohlbrenner VM, Hall DB, Scherer JR, Mayers DL (2006). Genotypic changes in human immunodeficiency virus type 1 protease associated with reduced susceptibility and virologic response to the protease inhibitor tipranavir. J Virol 80(21):10794-801. Epub 2006 Aug 23.
  • Deforche K, Silander T, Camacho R, Grossman Z, Soares MA, Van Laethem K, Kantor R, Moreau Y, Vandamme AM; non-B Workgroup (2006).Analysis of HIV-1 pol sequences using Bayesian Networks: implications for drug resistance. Bioinformatics 22(24):2975-9. Epub 2006 Oct 4.
  • Lanier ER, Givens N, Stone C, Griffin P, Gibb D, Walker S, Tisdale M, Irlbeck D, Underwood M, St Clair M, Ait-Khaled M (2004). Effect of concurrent zidovudine use on the resistance pathway selected by abacavir-containing regimens. HIV Med 5(6):394-9.
  • Margot NA, Miller MD (2005). In vitro combination studies of tenofovir and other nucleoside analogues with ribavirin against HIV-1. Antivir Ther 10(2):343-8.
  • Rhee SY, Taylor J, Wadhera G, Ben-Hur A, Brutlag DL, Shafer RW (2006). Genotypic predictors of human immunodeficiency virus type 1 drug resistance. Proceedings of National Academy of Sciences of the United States of America Oct 25, 2006.
  • Scherer J, Boucher CA, Baxter JD, Schapiro JM, Kohlbrenner VM, Hall DB (2007). Improving the prediction of virological response to tipranavir: the development of a tipranavir weighted score. [Poster P3.4/07] 11th European AIDS Conference; Madrid, Spain.
  • Vermeiren H, Van Craenenbroeck E, Alen P, Bacheler L, Picchio G, Lecocq P; Virco Clinical Response Collaborative Team (2007).Prediction of HIV-1 drug susceptibility phenotype from the viral genotype using linear regression modeling. J Virol Methods 145(1):47-55. Epub 2007 Jun 15.
  • Wirden M, Marcelin AG, Simon A, Kirstetter M, Tubiana R, Valantin MA, Paris L, Bonmarchand M, Conan F, Kalkias L, Katlama C, Calvez V (2005). Resistance mutations before and after tenofovir regimen failure in HIV-1 infected patients. J Med Virol 76(3):297-301.
 
version 4.3.1, 2007-09-25
the following NRTI mutation scores were updated
MutationDrugsScore
OldNew
70G3TC, FTC010
ABC020
DDI025
TDF015
D4T00
AZT120

Relevant reference:
  • Bradshaw D, Malik S, Booth C, Van Houtte M, Pattery T, Waters A, Ainsworth J, Geretti AM (2007) Characterization of a novel drug-resistance pattern associated with the mutations K70G and M184V in HIV-1 reverse transcriptase. Antimicrob Agents Chemother 2007 Sep 17; [Epub ahead of print].
 
version 4.3.0.3, 2007-09-22
Almost all comments were updated.
 
version 4.3.0.2, 2007-08-28
The abbreviation for the NNRTI drug Etravirine was changed from TMC125 to ETV.
 
version 4.3.0.1, 2007-08-23
the following NNRTI mutation scores were updated
MutationDrugsScore
OldNew
101EDLV, NVP2030
EFV1015
138KDLV, NVP020
EFV010
179FDLV, NVP2530
EFV1015
227CDLV, NVP030
EFV015
318FDLV3050
NVP1230

TMC125 was added with the following scores
MutationScore
98G5
98S0
100I20
100V10
101E/P15
101Q/R0
101H/N5
103N/S/T10
103R/Q/E5
106A/M10
106I/L0
108I5
138K20
179D/M10
179E10
179I/T/G/A0
179F40
181C30
181I/V30
181S10
188C10
188H15
188L20
190A15
190C/Q/V/T20
190E/S30
225H10
227C15
227L10
227Y/S0
230L20
234I0
236L/S0
238T/N/R0
318F0

Relevant references:
  • Andries K, Azijn H, Thielemans T, Ludovici D, Kukla M, Heeres J, Janssen P, De Corte B, Vingerhoets J, Pauwels R, De Bethune M-P. (2004) TMC125, a novel next-generation nonnucleoside reverse transcriptase inhibitor active against nonnucleoside reverse transcriptase inhibitor-resistant human immunodeficiency virus type 1. Antimicrob Agents Chemother 48(12):4680-6.
  • Brillant JE, Klumpp K, Swallow S, Mirzadegan T, Cammack N, Heilek-Snyder G. (2004) In vitro Resistance Development for a second generation NNRTI: TMC125. [Poster 16] XIII International Drug Resistance Workshop; Canary Islands, Spain.
  • Das K, Clark AD, Lewi PJ, Heeres J, De Jonge MR, Koymans LM, Vinkers HM, Daeyaert F, Ludovici DW, Kukla MJ, De Corte B, Kavash RW, Ho CY, Ye H, Lichtenstein MA, Andries K, Pauwels R, De Bethune M-P, Boyer PL, Clark P, Hughes SH, Janssen PA, Arnold E. (2004) Roles of conformational and positional adaptability in structure-based design of TMC125-R165335 (etravirine) and related non-nucleoside reverse transcriptase inhibitors that are highly potent and effective against wild-type and drug-resistant HIV-1 variants. J Med Chem 47(10):2550-60.
  • Harrigan PR, Salim M, Stammers DK, Wynhoven B, Brumme ZL, McKenna P, Larder B, Kemp SD. (2002) A mutation in the 3' region of the human immunodeficiency virus type 1 reverse transcriptase (Y318F) associated with nonnucleoside reverse transcriptase inhibitor resistance. J Virol 76(13):6836-40.
  • Katlama C, Campbell T, Clotet B, etal. (2007) DUET-2: 24 week results of a phase III randomised double-blind trial to evaluate the efficacy and safety of TMC125 versus placebo in 591 treatment-experienced HIV-1 infected patients. Abstract (late-breaker) WeSS204:2. 4th International AIDS Society Conference on HIV Pathogenesis, Treatment, and Prevention. Sydney, Australia.
  • TMC125-C223 Writing Group, Nadler JP, Berger DS, Blick G, Cimoch PJ, Cohen CJ, Greenberg RN, Hicks CB, Hoetelmans RM, Iveson KJ, Jayaweera DS, Mills AM, Peeters MP, Ruane PJ, Shalit P, Schrader SR, Smith SM, Steinhart CR, Thompson M, Vingerhoets JH, Voorspoels E, Ward D, Woodfall B. (2007) Efficacy and safety of etravirine (TMC125) in patients with highly resistant HIV-1: primary 24-week analysis. AIDS 21(6):F1-10.
  • Rhee SY, Taylor J, Wadhera G, Ben-Hur A, Brutlag DL, Shafer RW. (2006) Genotypic predictors of human immunodeficiency virus type 1 drug resistance. Proc Natl Acad Sci USA. 103(46):17355-60. Epub 2006 Oct 25.
  • Sato A, Hammond J, Alexander TN, Graham JP, Binford S, Sugita K, Sugimoto H, Fujiwara T, Patick AK (2006) In vitro selection of mutations in human immunodeficiency virus type 1 reverse transcriptase that confer resistance to capravirine, a novel nonnucleoside reverse transcriptase inhibitor. Antiviral Res 70(2):66-74. Epub 2006 Jan 25.
  • Su G, Li Y, Paul A, Hang J, Harris S, Hogg H, Dunn J, Yan J, Chow E, Cammack N, Klumpp K, Heilek G. (2007) In vitro Selection and Characterization of Viruses Resistant to R1206, a Novel Nonnucleoside Reverse Transcriptase Inhibitor. XVI International Drug Resistance Workshop; Barbados, Barbados.
  • Vingerhoets J, Buelens A, Peeters M, Picchio G, Tambuyzer L, Van Marck H, De Smedt G, Woodfall B, De Bethune M-P. (2007) Impact of Baseline NNRTI Mutations on the Virologic Response to TMC 125 in the Phase III Clinical Trials DUET-1 and DUET-2. [Oral Presentation] [Poster 32] XVI International Drug Resistance Workshop; Barbados, Barbados.
  • Vingerhoets J, Janssen P, Welkenhuysen-Gybels J, Peeters M, Cao-Van K, Tambuyzer L, Woodfall B, De Bethune M-P. (2006) Impact of baseline K103N or Y181C on the virological response to the NNRTI TMC125: analysis of study TMC125-C223. [Poster 17] XV International Drug Resistance Workshop; Sitges, Spain.
  • Vingerhoets J, Azijn H, Fransen E, De Baere I, Smeulders L, Jochmans D, Andries K, Pauwels R, De Bethune M-P. (2005) TMC125 displays a high genetic barrier to the development of resistance: evidence from in vitro selection experiments. J Virol 79(20):12773-82.
  • Vingerhoets J, De Baere I, Azijn H, Van den Bulcke T, McKenna P, Pattery T, Pauwels R, De Bethune M-P. (2004) Antiviral Activity of TMC125 against a Panel of Site-directed Mutants Encompassing Mutations Observed in vitro and in vivo. [Poster 621] 11th Conference on Retroviruses and Opportunistic Infections, San Francisco, CA.
  • Vingerhoets J, Van Marck H, Velderman J, Peeters M, McKenna P, Pauwels R, De Bethune M-P. (2003) Antiviral Activity of TMC125, a Potent Next-Generation Non-Nucleoside Reverse Transcriptase Inhibitor (NNRTI), against >5000 Recombinant Clinical Isolates exhibiting a wide range of NNRTI Resistance. [abstract 8] 12th International HIV Drug Resistance Workshop; Los Cabos, Mexico.
 
version 4.2.9, 2007-05-30
Updated PR and RT comments.
 
version 4.2.8, 2007-05-10
the following NRTI mutation scores were updated
MutationDrugsScore
OldNew
70E3TC, FTC015
70EABC, DDI025
70ETDF825
70EAZT120

Relevant references:
  • Delaunay C, Brun-Vezinet F, Landman R, Collin G, Peytavin G et al. (2005) Comparative selection of the K65R and M184V/I mutations in human immunodeficiency virus type 1-infected patients enrolled in a trial of first-line triple-nucleoside analog therapy (Tonus IMEA 021). J Virol 79(15): 9572-9578
  • Gallant JE, Rodriguez AE, Weinberg WG, Young B, Berger DS et al. (2005) Early Virologic Nonresponse to Tenofovir, Abacavir, and Lamivudine in HIV-Infected Antiretroviral-Naive Subjects. J Infect Dis 192(11): 1921-1930.
  • Ross L, Gerondelis P, Liao Q, Wine B, Lim ML et al. (2005) Selection of the HIV-1 reverse transcriptase mutation K70E in antiretroviral-naive subjects treated with tenofovir/abacavir/lamivudine therapy [abstract 92]. Antiviral Therapy 10 (Supplement 1): S102.
  • Sluis-Cremer N, Sheen CW, Zelina S, Argoti Torres PS, Parikh UM et al. (2006) Molecular Mechanism by which K70E in HIV-1 Reverse Transcriptase Confers Resistance to Nucleoside Reverse Transcriptase Inhibitors. Antimicrob Agents Chemother.
  • Van Houtte M, Staes M, Geretti A, Pattery T, Bacheler L (2006) NRTI resistance associated with the RT mutation K70E in HIV-1. Antivir Ther 11: S160.
 
version 4.2.6, 2006-12-12
the following PI mutation score was updated
MutationDrugsScore
OldNew
82LTPV3040

Relevant references:
  • Baxter JD, Schapiro JM, Boucher CA, Kohlbrenner VM, Hall DB, Scherer JR, Mayers DL. (2006) Genotypic changes in human immunodeficiency virus type 1 protease associated with reduced susceptibility and virologic response to the protease inhibitor tipranavir. J Virol. 80(21):10794-801.
  • Doyon L, Tremblay S, Bourgon L, Wardrop E, Cordingley MG. (2005). Selection and characterization of HIV-1 showing reduced susceptibility to the non-peptidic protease inhibitor tipranavir. Antiviral Res. 68(1):27-35.
 
version 4.2.5, 2006-12-04
the following PI mutations scores were updated
MutationDrugsScore
OldNew
20ILMRTVAll PIs10
63P10
16EATV20
77INFV20

Other changes included:
  • The list of major and minor protease inhibitor resistance mutations has been updated:
    • L76V has been added to the list of major mutations.
    • L23I, L24IF, L33FI, F53LY, G73ACST have been moved from the major mutation category to the minor mutation category.
    • Mutations at positions 20, 36, 63, and 77 have been moved from the minor mutation category to the other mutation category because they are highly polymorphic (meaning they occur commonly in the absence of therapy) and because in many cases substitutions at these positions represent the consensus amino acid in one or more non-B subtypes (Rhee AIDS 2006). Moreover, their contribution to decrease susceptibility is minimal and depends entirely on the presence of other mutations.
      In contrast, mutations at positions 10 and 71 occur in about 10% and 5% of PI-naive sequences from all subtypes and steadily increase in frequency with increasing therapy. Two mutations at position 10 (L10F/R) and one at position 71 (A71I) are also nonpolymorphic and remain as minor mutations.
    • V11I, E35G, K43T, Q58E, T74P, N83D, and L89V have been added to the minor mutation list.
  • The list of atypical mutations was updated.
  • In the "Mutation Scoring" tables, all mutations with scores are shown.
  • Atypical mutations are shown first.
All mutations at one of the major positions will appear in the "PI Major Resistance Mutations" list except for V82I which will appear in the "PR Other Mutations" list because it is polymorphic for most subtypes and is the consensus for subtype G.
Mutations at a minor position that are not on the minor mutation list will appear in "PR Other Mutations".

Classresistance positions with their most common / well-recognized mutations
PI MajorD30N, V32I, M46ILV, I47VA, G48VM, I50VL, I54VMLTAS, L76V, V82ATFTLSMC, I84VAC, N88DSTG, L90M
PI MinorL10IVFRY, V11I, L23I, L24IF, L33FI, E35G, K43T, F53LY, Q58E, A71VTI, G73CATS, T74P, N83D, L89V

Short summary descriptions of each of these mutations (as well as several others that are less clinically relevant) can be found at PI resistance note and using the mouse-over feature on the mutations listed on the left side of the page.

Relevant references:
  • Pellegrin I, Breilh D, Ragnaud JM, Boucher S, Neau D, Fleury H, Schrive MH, Saux MC, Pellegrin JL, Lazaro E, Vray M. (2006). Virological responses to atazanavir-ritonavir-based regimens: resistance-substitutions score and pharmacokinetic parameters (Reyaphar study). Antivir Ther. 11(4):421-9.
  • Rhee SY, Kantor R, Katzenstein DA, Camacho R, Morris L, Sirivichayakul S, Jorgensen L, Brigido LF, Schapiro JM, and Shafer RW for the international Non Subtype B HIV-1 Working Group (2006). HIV-1 pol mutation frequency by subtype and treatment experience: extension of the HIVseq program to seven non-B subtypes. AIDS 20(5):643-651.
 
version 4.2.4, 2006-11-21
the following PI mutations scores were updated
MutationDrugsScore
OldNew
20ILMRTVAll PIs21
71T21
74PNFV, SQV, TPV02
33FTPV208
35G02
43T02
50V0-5
58E02
82S2015
83D02
90M56
16EATV52

Other changes included:
  • drug name abbreviation for Prezista (darunavir) was changed from TMC114 to DRV
  • drug name abbreviation for Lexiva (fosamprenavir) was changed from fAPV to FPV
  • PI, NRTI, and NNRTI Comments were updated.

Relevant references:
  • Baxter JD, Schapiro JM, Boucher CA, Kohlbrenner VM, Hall DB,Scherer JR, Mayers DL. (2006). Genotypic changes in human immunodeficiency virus type 1 protease associated with reduced susceptibility and virologic response to the protease inhibitor tipranavir. J Virol. 80(21):10794-801.
  • Elston R, Scherer J, Hall D, Schapiro J, Bethell R, Kohlbrenner V and Mayers D. (2006). De-selection of the I50V mutation occurs in clinical isolates during aptivus/r (tipranavir/ritonavir)-based therapy. Antivir Ther. 11:s102.
  • Pellegrin I, Breilh D, Ragnaud JM, Boucher S, Neau D, Fleury H, Schrive MH, Saux MC, Pellegrin JL, Lazaro E, Vray M. (2006). Virological responses to atazanavir-ritonavir-based regimens: resistance-substitutions score and pharmacokinetic parameters (Reyaphar study). Antivir Ther. 11(4):421-9.
  • Piliero PJ, Parkin N, Mayers D. (2006). Impact of protease mutations L33F, V82A, I84V, and L90M on ritonavir (RTV)-boosted protease inhibitor susceptibility. 46th ICAAC. September 27-30, 2006. San Francisco. Abstract H-998.
 
version 4.2.3, 2006-10-11
PI
the following mutations were updated:
MutationDrugsScore
OldNew
10FTMC11442
32I1210
54L
46V86
76V812
36I/L/V/T/AAll PIs10
63PAll PIs21
 
version 4.2.2, 2006-09-18
PI
the following mutations were updated:
MutationDrugsScore
OldNew
46I/LTMC11486
54S/T/V/A
82F/A/S/T/M/L/C
90M
53LAll PIs53

PI Comments were updated.
 
version 4.2.1, 2006-07-31
TMC114 was added with the following scores:

MutationScore
10F4
10I/R/V/Y2
11I4
11F/T/C0
16A/E0
20I/M/R/T/V/L2
23I0
24I2
24F1
30N0
32I12
32A5
33F5
33V/I0
36I/L/V/T/A1
46I/L/V8
47V12
47A10
48V/M/A/S/T0
50V20
50L0
53L/Y5
54L/M12
54S/T/V/A8
63P2
71T/V/I2
73C2
73S/T5
73A2
76V8
77I0
82A/F8
82I0
82S/T/M/L/C8
84A/V/C12
88D/S/T/G0
89V4
89I/T2
89M0
90M8
93L/M0

A number of new mutations were added to PIs with the following scores:

MutationDrugsScore
11IfAPV4
ATV, IDV, LPV, NFV, SQV, TPV2
11F/T/CAll PIs0
76VfAPV, IDV12
NFV5
SQV, ATV-5
LPV8
TPV0
89VfAPV, NFV4
IDV2
SQV, LPV, ATV, TPV1
89I/TfAPV, NFV2
IDV, SQV, LPV, ATV, TPV1
89MAll PIs0

Ritonavir has been removed from the report because it is rarely, if ever, used except at low doses as a pharmacologic booster thus making it increasingly difficult to develop meaningful interpretations for this drug as the sole PI.

Comments were updated to reflect new PI drug TMC114.

Relevant references:
  • De Meyer S, Hill A, De Bacre I, Rimsky L, et al (2006). Effect of baseline susceptibility and on-treatment mutations on TMC114 and control PI efficacy: preliminary analysis of data from PI-experienced patients from POWER 1 and POWER 2. [Abstract 157] 13th Conference on Retroviruses and Opportunistic Infection; Denver, Colorado.
  • De Meyer S, Vangeneugden T, Lefebvre E, et al (2006). Phenotypic and genotypic determinants of resistance to TMC114: pooled analysis of POWER 1, 2 and 3. [Abstract 73] XV International Drug Resistance Workshop; Sitges, Spain.
  • Tibotec, Inc. (2006). Prezista (darunavir, TMC114) prescribing information. PDF version
 
version 4.2.0, 2006-05-24
NRTI
The following mutation was added
MutationsDrugsScore
65N3TC, FTC, TDF, DDI15
ABC10
AZT, D4T0

Relevant references:
  • Ross LL, Dretler R, Gerondelis P, Rouse EG, Lim ML, Lanier ER (2006). A rare HIV reverse transcriptase mutation, K65N, confers reduced susceptibility to tenofovir, lamivudine and didanosine. AIDS20(5):787-9.
 
version 4.1.9, 2006-02-24
PI
MutationDrugsOld ScoreNew Score
47VTPV810
54L/M/S/T105
54A1015
82T2025

Relevant references:
  • Parkin N and Chappey C. (2005). Protease mutations associated with higher or lower than expected Tipranavir (TPV) susceptibility basd on the TPV mutation score [poster 637]. 13th Conference on Retroviruses and Opportunistic Infections, Denver, CO.
PI
The following mutations were added
MutationsDrugsScore
20V/LAll PIs2
32AAll PIs5
36T/AAll PIs1
48A/S/TSQV30
NFV15
IDV, RTV, LPV, ATV5
fAPV, TPV0
82CIDV, NFV, RTV, LPV, TPV10
fAPV, SQV, ATV5
All Z scores were removed


NNRTI
The following mutations were added
MutationsDrugsScore
100VAll NNRTIs10
101H/NDLV, NVP15
EFV10
103EDLV, NVP15
EFV10
106LDLV, NVP10
EFV5
179MAll NNRTIs10
179T/G/AAll NNRTIs0
179FDLV, NVP25
EFV10
181SDLV, NVP30
EFV10
190TEFV, NVP60
DLV0
227SAll NNRTIs0
227YDLV, EFV0
NVP10
236SDLV25
EFV, NVP0
All Z scores were removed

NRTI
The following mutations were added
MutationsDrugsScore
67E3TC, FTC, TDF0
ABC, DDI5
AZT, D4T10
67S/T/H3TC, FTC0
ABC, AZT, D4T, DDI, TDF5
69EAll NRTIs2
70T/S/N3TC, FTC, ABC, DDI, TDF0
AZT, D4T5
75L3TC, FTC0
ABC, AZT, D4T, DDI, TDF2
151L3TC, FTC, TDF10
ABC, AZT, D4T, DDI20
210S/MAll NRTIs0
219W3TC, FTC0
ABC, DDI, TDF5
AZT, D4T10
219T3TC, FTC, ABC, DDI, TDF0
D4T5
AZT10
All Z scores were removed

 
version 4.1.8, 2006-01-31
PI
MutationDrugsOld ScoreNew Score
10FfAPV, ATV, IDV, LPV, NFV, RTV, SQV34
54AfAPV, ATV, IDV, LPV, NFV, RTV, SQV510
82LfAPV, ATV, IDV, LPV, NFV, RTV, SQVNA10
FPV was renamed fAPV

TPV was added with the following scores:

MutationScore
10F/I/R/Y2
10V3
10 (Not F/I/R/V/Y)0
16A/E0
16 (Not A/E)0
20I/M/R/T2
20 (Not I/M/R/T)2
23I0
24I2
24F1
24 (Not I/F)1
30N0
30 (Not N)0
32I8
32 (Not I)5
33F20
33V/I0
33 (Not F/V/I)0
36I/L/V1
36 (Not I/L/V)0
46I/L/V8
46 (Not I/L/V)5
47V8
47A5
47 (Not V/A)0
48V/M10
48 (Not V/M)5
50V/L0
50 (Not V/L)0
53L5
53Y2
53 (Not L/Y)0
54L/M/T/S/V/A10
54 (Not L/M/T/S/V/A)5
63P2
63 (Not P)0
71T/I2
71V3
71 (Not T/V/I)2
73C/S/T/A2
73 (Not C/S/T/A)2
77I0
77 (Not I)0
82A/M10
82F15
82S/T20
82I0
82L30
82 (Not A/F/I/S/T/M/L)15
84A/V/C25
84 (Not A/V/C)20
88D/S/T/G0
88 (Not D/S/T/G)0
90M5
90 (Not M)10
93L/M0
93 (Not L/M)0

Relevant references:
  1. Doyon L, Tremblay S, Bourgon L, Wardrop E, Cordingley MG. (2005). Selection and characterization of HIV-1 showing reduced susceptibility to the non-peptidic protease inhibitor tipranavir. Antiviral Res. 68(1):27-35.
  2. Larder BA, Hertogs K, Bloor S, van den Eynde CH, DeCian W, Wang Y, Freimuth WW, Tarpley G. (2000). Tipranavir inhibits broadly protease inhibitor-resistant HIV-1 clinical samples. AIDS. 14(13):1943-8.
  3. Boehringer Ingelheim Pharmaceuticals, Inc. (2006). Aptivus (Tipranavir) prescribing information. PDF version
 
version 4.1.7, 2006-01-20
PI
MutationDrugsOld ScoreNew Score
G16EATVNA5
APV, IDV, LPV, NFV, RTV, SQVNA0
G16AAPV, ATV, IDV, LPV, NFV, RTV, SQVNA0
G16 (Not A/E)APV, ATV, IDV, LPV, NFV, RTV, SQVNA0
L33FATV35
V82AATV2015
APV was renamed FPV

NRTI
MutationDrugsOld ScoreNew Score
T69deletionABC, ddI1525
AZT, D4T1530
TDF1015
K70RD4T510
L74VddI5055
ABC2530
L74IddI2530
M184V/IddI105
TDF-5-8
M184 (Not V/I)ddI100
T215C/D/E/I/S/VD4T1520
T215FddI1520
T215F/YD4T2530
T215 (Not C/D/E/F/I/S/V/Y)ABC, ddI, TDF50
D4T510
T219E/N/QABC, ddI, TDF50

NNRTI
MutationDrugsOld ScoreNew Score
K101EDLV, NVP1020
K101PDLV, EFV, NVP2030
K103NDLV7060
Y188LDLV2530
G190E/QDLV1215
G190CDLV120
G190VNVP, EFVNA60
DLVNA0
P225HDLV-100
M230LDLV7060
P236LDLV5060
NVP, EFV-100
K238TEFV1215

Comments were updated accordingly.

Relevant references:
  1. Huang, W., A. Gamarnik, K. Limoli, C. J. Petropoulos, and J. M. Whitcomb. (2003). Amino acid substitutions at position 190 of human immunodeficiency virus type 1 reverse transcriptase increase susceptibility to delavirdine and impair virus replication. J. Virol. 77:1512-23.
  2. Marcelin, A. G., P. Flandre, J. Pavie, N. Schmidely, M. Wirden, O. Lada, D. Chiche, J. M. Molina, and V. Calvez. (2005). Clinically relevant genotype interpretation of resistance to Didanosine. Antimicrob. Agents Chemother. 49:1739-44.
  3. Parkin, N. T., S. Gupta, C. Chappey, and C. J. Petropoulos. (2006). The K101P and K103R/V179D Mutations in Human Immunodeficiency Virus Type 1 Reverse Transcriptase Confer Resistance to Nonnucleoside Reverse Transcriptase Inhibitors. Antimicrob. Agents Chemother. 50:351-4.
  4. Vora, S., A. G. Marcelin, H. F. Gunthard, P. Flandre, H. H. Hirsch, B. Masquelier, A. Zinkernagel, G. Peytavin, V. Calvez, L. Perrin, and S. Yerly. (2006). Clinical validation of atazanavir/ritonavir genotypic resistance score in protease inhibitor-experienced patients. Aids 20:35-40.
 
version 4.1.4, 2005-06-20
PI
MutationDrugsOld ScoreNew Score
V82MAPV,ATV,LPV,NFV,RTV,SQV NA10
V82MIDVNA15

NRTI
MutationDrugsOld ScoreNew Score
K70R/ETDF08

Comments were updated accordingly.

Relevant references:
  1. Delaugerre C, Roudiere L, Peytavin G, Rouzioux C, Viard JP, Chaix ML (2005). Selection of a rare resistance profile in an HIV-1-infected patient exhibiting a failure to an antiretroviral regimen including tenofovir DF. J Clin Virol. 2005 Mar; 32(3): 241-4.
  2. L Ross, P Gerondelis, Q Liao, B Wine, M Lim, M Shaefer, A Rodriguez, K Limoli, W Huang, NT Parkin, J Gallant, R Lanier (2005). Selection of the HIV-1 Reverse Transcriptase Mutation K70E in Antiretroviral-Naive Subjects Treated with Tenofovir/Abacavir/Lamivudine Therapy. [abstract 92] Antivir. Ther. Volume 10:S102
  3. R Camacho, AR Godinho, P Gomes, A Abecasis, A-M Vandamme, C Palma, AP Carvalho, J Cabanas, K Goncalves (2005). Different substitutions under drug pressure at protease codon 82 in HIV-1 subtype G compared to subtype B infected individuals including a novel I82M resistance mutation. [abstract 138] Antivir. Ther. Volume 10:S151
 
version 4.1.3, 2005-05-26
Updated the <ALG_VERSION> tag in the xml to reflect the version number instead of the month.
 
version 4.1.2, 2005-04-11
PI
MutationDrugsOld ScoreNew Score
N88SNFV2540
N88DSQV510
V82IAPV,NFV50

NNRTI
MutationDrugsOld ScoreNew Score
K101QDLV,EFV,NVP50

Relevant references:
  1. Eoin Coakley, M Mass, and N Parkin (2005). Atazanavir Resistance in a Protease Inhibitor-nave Patient Treated with Atazanavir/Ritonavir Associated with Development of High-level Atazanavir Resistance and the N88S Mutation in Protease. [abstract 716] Conference on Retroviruses and Opportunistic Infections, Boston, MA.
 
version 4.1.1, 2005-04-05
NNRTI
MutationDrugsOld ScoreNew Score
V106MDLV,EFV,NVP5060
 
version 4.1, 2005-03-17
Protease
MutationDrugsOld ScoreNew Score
N88SIDV510
ATV1530
N88TRTV50
N88GAPV, RTV, LPVNA0
IDV, SQVNA5
ATVNA15
NFVNA25

NRTI
MutationDrugsOld ScoreNew Score
M41L3TC, FTC04
L210W04
T215F/Y04
T69insert2025
L74IABC1220
L74V2025
Y115F2025

Relevant references:
  1. Soo-Yon Rhee, Tommy Liu, Jaideep Ravela, Matthew J. Gonzales and Robert W. Shafer (2004). Distribution of Human Immunodeficiency Virus Type 1 Protease and Reverse Transcriptase Mutation Patterns in 4,183 Persons Undergoing Genotypic Resistance Testing. Antimicrobial Agents and Chemotherapy 48(8):3122-3126
  2. Eoin Coakley, M Mass, and N Parkin (2005). Atazanavir Resistance in a Protease Inhibitor-nave Patient Treated with Atazanavir/Ritonavir Associated with Development of High-level Atazanavir Resistance and the N88S Mutation in Protease. [abstract 716] Conference on Retroviruses and Opportunistic Infections, Boston, MA.
 
version 4.0, 2004-10-27
Protease
MutationDrugsOld ScoreNew Score
L10FAll23
L23INFV015
L24FAll21
L33FAPV,RTV,LPV35
M36I/V/LAll21
M46IAPV2012
M46LAPV1512
M46VAPV1510
M46I/LIDV,RTV, LPV1012
M46VLPV510
M46I/LATV1015
M46LNFV2025
I47VIDV105
I47ALPV2040
G48V/MAPV105
LPV510
G48MSQV4050
I50VAPV4050
I50LATV4050
F53LSQV105
F53YSQV52
I54VSQV1015
I54AATV105
A71VAll43
G73C/S/TSQV510
G73S/C/T/AAPV,LPV52
V77INFV12
V82A/F/S/TLPV1820
V82INFV105
I84VAPV,NFV,SQV4035
I84AAPV4035
RTV2535
ATV2025
I84CRTV1520
N88D/SRTV50
SQV25
LPV30
N88S/TATV1015
N88TSQV25
I93LAll10

Relevant references:
  1. Clevenbergh, P., R. Boulme, M. Kirstetter, and P. Dellamonica. 2004. Efficacy, safety and predictive factors of virological success of a boosted amprenavir-based salvage regimen in heavily antiretroviral-experienced HIV-1-infected patients. HIV Med 5:284-8.
  2. Colonno, R., R. Rose, C. McLaren, A. Thiry, N. Parkin, and J. Friborg. 2004. Identification of I50L as the signature atazanavir (ATV)-resistance mutation in treatment-naive HIV-1-infected patients receiving ATV-containing regimens. J. Infect. Dis. 189:1802-10.
  3. Colonno, R. J., A. Thiry, K. Limoli, and N. Parkin. 2003. Activities of Atazanavir (BMS-232632) against a Large Panel of Human Immunodeficiency Virus Type 1 Clinical Isolates Resistant to One or More Approved Protease Inhibitors. Antimicrob. Agents. Chemother. 47:1324-33.
  4. Johnston, E., M. A. Winters, S. Y. Rhee, T. Merigan, C. A. Schiffer, and R. W. Shafer. 2004. A novel HIV-1 protease substrate-cleft mutation, L23I: Association with protease inhibitor therapy and in vitro resistance. Antimicrob Agents Chemother (In press).
  5. Marcelin, A. G., C. Lamotte, C. Delaugerre, N. Ktorza, H. Ait Mohand, R. Cacace, M. Bonmarchand, M. Wirden, A. Simon, P. Bossi, F. Bricaire, D. Costagliola, C. Katlama, G. Peytavin, and V. Calvez. 2003. Genotypic inhibitory quotient as predictor of virological response to ritonavir-amprenavir in human immunodeficiency virus type 1 protease inhibitor-experienced patients. Antimicrob. Agents. Chemother. 47:594-600.
  6. Mo, H., N. Parkin, K. Stewart, L. Lu, T. Dekhtyar, D. Kempf, and A. Molla. 2003. I84A and I84C mutations in protease confer high-level resistance to protease inhibitors and impair replication capacity Antivir. Ther. Volume 8:S56.
  7. Parkin, N., C. Petropoulos, C. Chappey, J. Friend, T. Liegler, J. Martin, and S. Deeks. 2004. Isolated lopinavir resistance after virological rebound of a lopinavir/ritonavir-based regimen Antivir. Ther. Volume 9:S79.
  8. Parkin, N. T., C. Chappey, and C. J. Petropoulos. 2003. Improving lopinavir genotype algorithm through phenotype correlations: novel mutation patterns and amprenavir cross-resistance. AIDS 17:955-61.
  9. Rhee SY, Liu T, Ravela J, Gonzales MJ and Shafer RW. 2004. Distribution of human immunodeficiency virus type 1 protease and reverse transcriptase mutation patterns in 4,183 persons undergoing genotypic resistance testing. Antimicrob Agents Chemother 48:3122-6
  10. Yerly, S., S. Vora, H. Günthard, P. Vernazza, H. Furrer, A. Zinkernagel, B. Hirschel, L. Perrin, and t. S. H. C. S. (SHCS). 2004. Virological response following switch to atazanavir/ritonavir in relation to baseline genotypic resistance pattern Antivir. Ther. Volume 9:S165
  11. Genotype-phenotype correlations in Stanford HIVRT&PrDB
NRTI
MutationDrugsOld ScoreNew Score
E44D/A3TC,FTC85
T69A/I/S3TC,FTC52
T69insertion3TC,FTC3020
V75I, F77L, F116Y3TC,FTC45
V118I3TC,FTC85
M41LD4T1215
A62VAZT,D4T52
K65RAZT0-5
67deletionAZT1830
D4T1230
D67N/G/EAZT1815
T69A/I/SAZT,D4T52
T69insertionAZT,D4T2530
T69D/ND4T1210
T69GD4T510
L74VAZT-8-5
L74IAZT-80
V75A/ID4T2010
V75TD4T5030
L210WAZT,D4T1215
T215C/D/ED4T515
T215SD4T1015
K219Q/E/NAZT1815
D4T1210
M41LDDI,TDF1012
A62VABC,DDI52
K65RABC2025
67deletionABC1025
DDI525
TDF515
D67N/G/EABC108
DDI58
T69insertionABC2530
T69NDDI2010
T69S/A/IABC,TDF52
T69A/IDDI105
T69GDDI520
K70RABC,DDI,TDF50
L74VABC2520
L74IABC2512
DDI5025
V75A/I/M/TTDF35
F77LTDF25
Y115FABC1520
F116YTDF35
M184V/IABC1612
DDI1210
TDF-8-5
L210WDDI1012
T215YDDI1220
T215FDDI1215
T215C/D/E/I/V/SABC,TDF510
T215C/D/E/SDDI010
T215I/VDDI510
K219Q/E/NABC105
K219RABC100
TDF50

Relevant references:
  1. Brun-Vezinet, F., D. Descamps, A. Ruffault, B. Masquelier, V. Calvez, G. Peytavin, F. Telles, L. Morand-Joubert, J. L. Meynard, M. Vray, and D. Costagliola. 2003. Clinically relevant interpretation of genotype for resistance to abacavir. AIDS 17:1795-1802.
  2. De Luca, A., M. Vendittelli, F. Baldini, S. Di Giambenedetto, M. P. Trotta, A. Cingolani, A. Bacarelli, C. Gori, C. F. Perno, A. Antinori, and G. Ulivi. 2004. Construction, training and clinical validation of an interpretation system for genotypic HIV-1 drug resistance based on fuzzy rules revised by virological outcomes. Antivir. Ther. 9:583-93.
  3. Elion, R., C. Cohen, E. DeJesus, R. Redfield, J. Gathe, R. Hsu, L. Yau, L. Ross, B. Ha, E. Lanier, and T. Scott. 2004. COL40263: Resistance and efficiacy of once-daily trizivir and tenofovir DF in antiretroviral naive subjects [abstract 53]. 11th Conference on Retroviruses and Opportunistic Infections, San Francisco, CA.
  4. Lanier, E., M. Ait-Khaled, J. Scott, C. Stone, T. Melby, G. Sturge, M. St Clair, H. Steel, S. Hetherington, G. Pearce, B. Spreen, and S. Lafon. 2004. Antiviral efficacy of abacavir in antiretroviral-therapy experienced adults harbouring HIV-1 with specific patterns of resistance to nucleoside reverse transcriptase inhibitors. Antivir. Ther. 9:37-45.
  5. Lanier, E., D. Irlbeck, L. Ross, P. Gerondelis, M. R. Underwood, N. Parkin, C. Chappey, and M. St Clair. 2003. Prediction of NRTI options by linking RT genotype and phenotype breakpoings [abstract 586]. 10th Conference on Retroviruses and Opportunistic Infections, Boston, MA.
  6. Marcelin, A., P. Flandre, J. Pavie, N. Schmidely, M. Wirden, O. Lada, D. Chiche, M. Bernard, J. Molina, and V. Calvez. 2004. New genotypic score comprising mutations impacting negatively and positively the virological response to didanosine in treatment-experienced patients from the randomized didanosine add on Jaguar study Antivir. Ther. Volume 9:S146.
  7. Masquelier, B., E. Race, C. Tamalet, D. Descamps, J. Izopet, C. Buffet-Janvresse, A. Ruffault, A. S. Mohammed, J. Cottalorda, A. Schmuck, V. Calvez, E. Dam, H. Fleury, and F. Brun-Vezinet. 2001. Genotypic and phenotypic resistance patterns of human immunodeficiency virus type 1 variants with insertions or deletions in the reverse transcriptase (RT): multicenter study of patients treated with RT inhibitors. Antimicrob. Agents. Chemother. 45:1836-42.
  8. Masquelier, B., C. Tamalet, B. Montes, D. Descamps, G. Peytavin, L. Bocket, M. Wirden, J. Izopet, V. Schneider, V. Ferre, A. Ruffault, P. Palmer, A. Trylesinski, M. Miller, F. Brun-Vezinet, and D. Costagliola. 2004. Genotypic determinants of the virological response to tenofovir disoproxil fumarate in nucleoside reverse transcriptase inhibitor-experienced patients. Antivir. Ther. 9:315-23.
  9. Miller, M. D., N. Margot, B. Lu, L. Zhong, S. S. Chen, A. Cheng, and M. Wulfsohn. 2004. Genotypic and phenotypic predictors of the magnitude of response to tenofovir disoproxil fumarate treatment in antiretroviral-experienced patients. J. Infect. Dis. 189:837-46.
  10. Rhee SY, Liu T, Ravela J, Gonzales MJ and Shafer RW. 2004. Distribution of human immunodeficiency virus type 1 protease and reverse transcriptase mutation patterns in 4,183 persons undergoing genotypic resistance testing. Antimicrob Agents Chemother 48:3122-6
  11. Violin, M., A. Cozzi-Lepri, R. Velleca, A. Vincenti, S. D'Elia, F. Chiodo, F. Ghinelli, A. Bertoli, A. d'Arminio Monforte, C. F. Perno, M. Moroni, and C. Balotta. 2004. Risk of failure in patients with 215 HIV-1 revertants starting their first thymidine analog-containing highly active antiretroviral therapy. AIDS 18:227-35.
  12. Whitcomb, J. M., N. T. Parkin, C. Chappey, N. S. Hellmann, and C. J. Petropoulos. 2003. Broad nucleoside reverse-transcriptase inhibitor cross-resistance in human immunodeficiency virus type 1 clinical isolates. J. Infect. Dis. 188:992-1000.
  13. Winters, M. A., K. L. Coolley, P. Cheng, Y. A. Girard, H. Hamdan, L. C. Kovari, and T. C. Merigan. 2000. Genotypic, phenotypic, and modeling studies of a deletion in the beta3- beta4 region of the human immunodeficiency virus type 1 reverse transcriptase gene that is associated with resistance to nucleoside reverse transcriptase inhibitors. J. Virol. 74:10707-13.
  14. Genotype-phenotype correlations in Stanford HIVRT&PrDB
NNRTI
MutationDrugsOld ScoreNew Score
A98GDLV,EFV105
K101QALL105
K103QALL510
Y181VDLV,NVP3060
EFV1020
G190AEFV5040
L234IALL120

Relevant references:
  1. Rhee SY, Liu T, Ravela J, Gonzales MJ and Shafer RW. 2004. Distribution of human immunodeficiency virus type 1 protease and reverse transcriptase mutation patterns in 4,183 persons undergoing genotypic resistance testing. Antimicrob Agents Chemother 48:3122-6
  2. Genotype-phenotype correlations in Stanford HIVRT&PrDB
Interpretation for ddC is no longer provided
 
version 3.9, 2004-03-25
Several comments for Protease and RT positions were updated. FTC was added with scores identical to 3TC:

MutationScore
41L0
44A/D8
62V0
65R30
65 (Not R)10
67del15
67E/G/N0
69del15
69A/I/D/N/S5
69ins30
69 (Not A/I/D/N/S)5
70RGE0
74IV0
75A/M/T/S0
75I4
77L4
100I0
115F0
116Y4
118I8
151L10
151M15
151 (Not L/M)5
181C0
184I/V60
184 (Not IV)30
210FW0
215C/D/E/F/I/V/S/Y0
219E/N/Q/R0
333D/E0

Protease
MutationDrugsOld ScoreNew Score
48 (Not VM)SQV1015
48MAPV, IDV, RTV, ATVna10
LPVna5
NFVna25
SQVna40
73AAPV, IDV, NFV, RTV, SQV, LPV, ATVna5
82FLPV1518
82INFV510
82TLPV1518
84VLPV1012

NRTI
MutationDrugsOld ScoreNew Score
41LABC1012
DDC, DDI510
44A/DABC, AZT, D4T, DDC, DDI, TDF02
67NDDC, DDI25
67 (Not E/G/N)DDC, DDI35
74I/VAZT-10-8
D4T-50
100IAZT-10-4
TDF-5-4
118IABC, AZT, D4T, DDC, DDI, TDF02
181CAZT, TDF-5-4
184IAZT, TDF-10-8
184VABC2016
AZT-10-8
DDI2012
TDF-10-8
210WABC, D4T, TDF1012
DDC, DDI510
215F/YDDC, DDI1012

NNRTI
MutationDrugsOld ScoreNew Score
98 (Not GS)DLV, EFV, NVP50
101PDLV, EFV, NVP1020
106IDLV, EFV, NVP50

Relevant references:
  1. Molina, J. M., G. Marcelin, J. Pavie, C. Merle, M. Troccaz, G. Leleu, and V. Calvez. (2003). Didanosine (ddI) in treatment experienced HIV-infected patients: results from a randomized double-blind study. (AI454-176 Jaguar) [Abstract H-447]. 43rd Interscience Conference on Antimicrobial Agents and Chemotherapy. Chicago, IL.
 
version 3.8.1, 2003-12-15
NRTI
MutationDrugsOld ScoreNew Score
65RTDF3040

The resistance mutations were further classified; Major and Minor Resistance mutations for Protease Inhibitors, and NRTI and NNRTI Resistance Mutations for RT Inhibitors.

Relevant references:
  1. Gallant J, Rodriguez AE, Weinberg W. (2003). Early non-response to tenofovir DF (TDF) + abacavir (ABC) and lamivudine (3TC) in a randomized trial compared to efavirenz (EFV) + ABC and 3TC: ESS30009 [Abstract 1722a].43rd Interscience Conference on Antimicrobial Agents and Chemotherapy. Chicago, IL.
 
version 3.8, 2003-10-15
Protease
MutationDrugsOld ScoreNew Score
84VATV2025

NRTI
MutationDrugsOld ScoreNew Score
184 (Not I/V)AZT-100
184 (Not I/V)D4T-50

NNRTI
MutationDrugsOld ScoreNew Score
101QDLV, EFV, NVP510
236 (Not L)EFV, NVP-50

In order to minimize the number of X amino acids being called, we updated our triplets table. We now translate a codon to X only when the amino acid mixture is greater than four, ie. now, codon YYY translates to FLPS and ANY to INST, when previously they translated to X.
 
version 3.7, 2003-09-16
NRTI
MutationDrugsOld ScoreNew Score
106MEFV1550

NNRTI
MutationDrugsOld ScoreNew Score
75A/I/M/SD4T3020
 
version 3.6, 2003-08-01
  • The Protease Resistance Notes page was updated; position 47 is now responsible for Intermediate Resistance to LPV, instead of Contributing to Resistance.
  • Many scores were updated for Protease and RT, and a new Protease drug was added, ATV.
ATV was added with the following scores:

MutationScore
10F/I/R/V2
10 (Not F/I/R/V)2
20I/M/R2
20 (Not I/M/R)2
24I/F2
24 (Not I/F)2
30N0
30 (Not N)0
32I10
32 (Not I)2
33F3
33V/I0
33 (Not F/V/I)0
36I/L/V2
36 (Not I/L/V)2
46I/L/V10
46 (Not I/L/V)5
47V/A5
47 (Not V/A)5
48V10
48 (Not V)10
50V0
50L40
50 (Not V/L)20
53L5
53Y2
53 (Not L/Y)0
54L/M/T/S/V/A10
54 (Not L/M/T/S/V/A)5
63P2
63 (Not P)1
71T/I2
71V4
71 (Not T/V/I)2
73C/S/T5
73 (Not C/S/T)2
77I0
77 (Not I)0
82A/F/S/T20
82I0
82 (Not A/F/I/S/T)15
84A/V/C20
84 (Not A/V/C)10
88D/S/T10
88 (Not D/S/T)5
90M20
90 (Not M)20
93L1
93 (Not L)0

Relevant references:
  1. Colonno (2000).
  2. Colonno (2002).
  3. Colonno (2003).
  4. Gong (2000).
 
version 3.5.1, 2003-07-25
Several comments were updated for Protease and RT positions.
 
version 3.5, 2003-07-10
Almost all comments for Protease and RT positions were updated.
Protease
MutationDrugsOld ScoreNew Score
47VAPV2520
LPV510
47AAPV, LPV020
IDV, NFV, RTV, SQV05
47 (Not V/A)LPV210
IDV, NFV, RTV, SQV25
84AAPV, NFV, SQV040
IDV, RTV025
LPV010
84CAPV, NFV, SQV025
IDV, RTV015
LPV010

NRTI
MutationDrugsOld ScoreNew Score
65RD4T015

NNRTI
MutationDrugsOld ScoreNew Score
103SDLV, NVP3060
EFV3050
103TDLV, NVP3060
EFV3050
103QDLV, EFV, NVP05

Relevant references:
  1. Harrigan (2003).
  2. Kagan (2003).
  3. Mo (2003).
  4. Parkin (2003). Garcia-Lerma (2003).
 
version 3.4, 2003-06-09
  • Comments were added to the HIVDB algorithm to include RT positions 238 and 333. In addition comments for protease positions 20, 32, 46, 47, 54, 63, and 82, and RT positions 65, 74, 98, 101, 103, 151, 184, and 215 were updated.
  • The default font for the reports has been increased for improved readability.
 
version 3.3.1, 2003-05-02
  • Mutations at RT position 238 are now classified as resistance mutations
  • RT mutation V106M now has a comment describing its involvement in NNRTI resistance, and is no longer classified as an 'atypical' mutation
  • The default setting for the programs is now the mutation input form, rather than the sequence input form.
Relevant references:
  1. Brenner, B, et al. (2003).
 
version 3.3, 2003-04-25
The programs now accept as input Visible Genetics sequencer files (GRFs)
Protease
MutationDrugsOld ScoreNew Score
V32ILPV310
L33F/VNFV02
RTV02
G48 (Not V)APV, IDV, LPV, RTV05
NFV, SQV010
I54LAPV1015
LPV1012
I54MLPV1012

Relevant references:
  1. Parkin, NT, et al. (2003).
 
version 3.2, 2003-03-04
  • The results of subtyping analysis by reference sequence comparison are now rounded to one decimal point, rather than the integer value.
  • RT mutations V179I and A98S are no longer classified as resistance mutations
  • V179I is no longer classified as an atypical mutation
  • If no sequence identifier is provided but the file uploaded feature has been used, the sequence name becomes the name of the submitted file
  • General comments are now sorted by position number
 
version 3.1, 2003-02-19
Internal Release
 
version 3.0, 2003-01
A local alignment progam (LAP), instead of the previous global alignment program (NAP), is now used.